Deck 10: DNA: the Chemical Nature of the Gene

Question 1

How did Albert Kossel contribute to our understanding of DNA?

A) used X-ray diffraction to examine the structure of DNA
B) determined that DNA contains four different nitrogenous bases
C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D) found that the phosphorus-containing components are the genetic material of phages
E) discovered "the transforming principle" that could genetically alter bacteria

Answer 1

B

Question 2

How did Avery, MacLeod, and McCarty contribute to our understanding of DNA?

A) used X-ray diffraction to examine the structure of DNA
B) determined that DNA contains four different nitrogenous bases
C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D) found that the phosphorus-containing components are the genetic material of phages
E) discovered "the transforming principle" that could genetically alter bacteria

Answer 2

C

Question 3

In the Hershey-Chase experiment, proteins and DNA were differentially labeled in order to follow where they were present. The specific labels were:

A) 3H for protein and 15N for DNA.
B) 35S for protein and 15N for DNA.
C) 35S for protein and 32P for DNA.
D) 32P for protein and 35S for DNA.
E) 15N for protein and 32P for DNA.

Answer 3

C

Question 4

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA?

A) used X-ray diffraction to examine the structure of DNA
B) determined that DNA contains four different nitrogenous bases
C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D) found that the phosphorus-containing components are the genetic material of phages
E) discovered "the transforming principle" that could genetically alter bacteria

Question 5

How did Chargaff's rules contribute to Watson and Crick's elucidation of the structure of DNA?

Question 6

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow.

-You wish to discover which of those three molecules could be the genetic material. You heat-kill some of the purple life form and subject three different homogenized samples to different enzymes: DNase, RNase, or protease. Which sample will NOT transform yellow into purple?

A) DNase
B) RNase
C) protease
D) All will cause transformation.
E) None will cause transformation.

Question 7

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow.

-You wish to discover which of those three molecules could be the genetic material. The classic experiment of which of the following scientists would be the MOST appropriate to mimic?

A) Hershey, Chase
B) Avery, MacLeod, McCarty
C) Franklin
D) Griffith
E) Fraenkel-Conrat, Singer

Question 8

How did Fred Griffith contribute to our understanding of DNA?

A) used X-ray diffraction to examine the structure of DNA
B) determined that DNA contains four different nitrogenous bases
C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D) found that the phosphorus-containing components are the genetic material of phages
E) discovered "the transforming principle" that could genetically alter bacteria

Question 9

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral DNA?

A) ¹⁴C
B) ¹⁵N
C) ¹⁸O
D) ³²P
E) ³⁵S

Question 10

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow.

-You decide to attempt a transformation: seeing if you can covert the purple form into the yellow form. From which sample(s) would you find some yellow form? (Select all that apply.)

A) live yellow form
B) heat-killed yellow form
C) purple form
D) heat-killed purple form

Question 11

How did Rosalind Franklin contribute to our understanding of DNA?

A) used X-ray diffraction to show that the structure of DNA is helical
B) determined that DNA contains four different nitrogenous bases
C) found that "the transforming principle" is destroyed by enzymes that hydrolyze DNA
D) found that the phosphorus-containing components are the genetic material of phages
E) used models to show that DNA is a double helix

Question 12

Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA?

A) in the cell pellet
B) in the supernatant
C) in bacteriophage coats
D) in both the cell pellet and supernatant

Question 13

Why were bacteriophages used in the Hershey-Chase experiment? (Select all that apply.)

A) They had a protein coat and an internal DNA molecule.
B) They had a DNA coat and an internal protein molecule.
C) Their proteins and DNA were mixed together.
D) They injected protein inside bacterial cells.
E) They injected their genetic material into bacterial cells.

Question 14

Which hypothesis contributed to the mistaken idea that protein is the genetic material because, with its 20 different amino acids, protein structure could be more variable than that of DNA?

A) tetranucleotide hypothesis
B) central dogma hypothesis
C) RNA world hypothesis
D) one gene-one enzyme hypothesis
E) adaptor hypothesis

Question 15

How did Chargaff's rules contribute to Watson and Crick's elucidation of the structure of DNA?

A) The rules suggested an equal concentration of sugars and phosphates.
B) The rules suggested the amounts of all four bases were equal.
C) The rules suggested the base-pairing combinations of adenine with thymine and guanine with cytosine.
D) The rules suggested that each base corresponds to an amino acid.

Question 16

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral protein?

A) ¹⁴C
B) ¹⁵N
C) ¹⁸O
D) ³²P
E) ³⁵S

Question 17

Indicate which of the following statements is FALSE.

A) Covalent bonds connect nucleotides in a strand; noncovalent interactions hold strands into a double-stranded structure.
B) Uracil is similar to thymine except that uracil lacks a methyl group on the carbon at position 5 on the carbon-nitrogen ring.
C) Frederick Griffith demonstrated that a transforming chemical from dead bacteria could change the genetic information of living bacteria.
D) Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.
E) The pyrimidine bases in nucleic acids are cytosine, thymine, and uracil.

Question 18

Which of the following is NOT a key characteristic that genetic material must possess?

A) Genetic material must contain complex information.
B) Genetic material must replicate faithfully.
C) Genetic material must encode the phenotype.
D) Genetic material must have the capacity to vary.
E) Genetic material must contain nitrogen but not sulfur.

Question 19

List four characteristics required of genetic material. For each characteristic, indicate how the structure of DNA helps us to understand the characteristic.

Question 20

Why was the idea that genes are made of nucleic acids NOT widely accepted until after 1950?

A) Proteins are more abundant than nucleic acids, so it seemed more logical that proteins would carry genetic information.
B) Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear.
C) Amino acids existed in the prebiotic environment, so they would have most likely been the first to carry genetic information for life.
D) DNA was not chemically stable for long enough to be a good method of storing genetic information.
E) Nothing was known about the chemistry of DNA until after 1950.

Question 21

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the LOWEST temperature?

A) 10% AT and 90% GC
B) 30% AT and 70% GC
C) 50% AT and 50% GC
D) 70% AT and 30% GC
E) 90% AT and 10% GC

Question 22

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?

A) 30%
B) 60%
C) 35%
D) 70%
E) 15%

Question 23

The bonds that connect nucleotides in a single strand are called _____ bonds.

A) phosphodiester
B) peptide
C) ionic
D) hydrogen
E) glycosidic

Question 24

With respect to their 3' and 5' ends, the two polynucleotide chains of a double-stranded DNA molecule are:

A) antiparallel.
B) parallel.
C) methylated.
D) complementary.
E) nitrogenous.

Question 25

Indicate which of the following statements is TRUE.

A) There are three phosphates between each sugar in a molecule of DNA.
B) A-, B-, and Z-form DNA are all right-handed helixes.
C) There are three hydrogen bonds between AT pairs.
D) Ribose sugars have a hydroxyl on the 2'carbon.
E) All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25% C.

Question 26

A molecule that consists of a nitrogenous base bonded to the 1' carbon of a ribose or deoxyribose is a(n):

A) nucleoside.
B) hairpin.
C) isotope.
D) polynucleotide.
E) nucleotide.

Question 27

Which of the following is NOT characteristic of A-form DNA compared to B- or Z-form DNA?

A) has right-handed helixes
B) exists when less water is present
C) is long and narrow
D) has 50% purines, 50% pyrimidines

Question 28

Which circle shows a noncovalent bond?

A) circle a
B) circle b
C) circle c
D) circle d

Question 29

Summarize the evidence that RNA serves as the genetic material in tobacco mosaic virus (TMV).

Question 30

Which circle shows a phosphodiester bond?

A) circle a
B) circle b
C) circle c
D) circle d

Question 31

Which term CORRECTLY describes the molecule below?

A) thymine base
B) purine base
C) pyrimidine base
D) nucleotide
E) amino acid

Question 32

How did the work of Hershey and Chase contribute to the conclusion that DNA is the genetic material? What technique helped them to distinguish between viral DNA and protein?

Question 33

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. Fortuitously, you collected two strains, one that is purple and one that is yellow. What experiments would you perform to determine which of these three cellular constituents serves as the genetic material in your new organism?

Question 34

What is the difference in hydrogen bonding between A/T pairs versus G/C pairs?

A) A/T pairs have one more hydrogen bond than G/C pairs.
B) G/C pairs have one more hydrogen bond than A/T pairs.
C) A/T pairs have two more hydrogen bonds than G/C pairs.
D) G/C pairs have two more hydrogen bonds than A/T pairs.
E) G/C pairs have three more hydrogen bonds than A/T pairs.

Question 35

If a DNA molecule contains 27% cytosine bases (C), then what percentage of thymine bases will it have?

A) 10%
B) 27%
C) 46%
D) 23%
E) 52%

Question 36

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the HIGHEST temperature?

A) 10% AT and 90% GC
B) 30% AT and 70% GC
C) 50% AT and 50% GC
D) 70% AT and 30% GC
E) 90% AT and 10% GC

Question 37

A DNA molecule of 50 base pairs contains 15 cytosine bases (C). How many thymine bases will it have?

A) 10
B) 15
C) 30
D) 35
E) 60

Question 38

If the sequence of one strand of DNA is 5'-GCTAGCGTCG-3', what is the sequence of the complementary strand?

A) 3'-GCTAGCGTCG-5'
B) 5'-GCTGCGATCG-3'
C) 3'-CGATCGCAGC-5'
D) 5'-CGATCGCAGC-3'
E) 5'-CGAUCGCAGC-3'

Question 39

The concept that genetic information passes from DNA to RNA to protein is called the:

A) central dogma.
B) nitrogenous base.
C) transforming principle.
D) polynucleotide strand.
E) reverse transcription.

Question 40

Which circle shows a bond that would also be found in an RNA transcribed from one strand of this DNA?

A) circle a
B) circle b
C) circle c

Question 41

What type of secondary structure is formed by the pairing of three strands of DNA?

A) A-DNA
B) B-DNA
C) C-DNA
D) H-DNA
E) Z-DNA

Question 42

A high-resolution X-ray diffraction technique was used to obtain detailed secondary structure of a DNA molecule. The characteristics of the DNA showed it was a left-handed helix with a general shape that was longer and narrower than the classic Watson-Crick model of DNA. Which form of DNA was resolved?

A) A-DNA
B) B-DNA
C) Z-DNA
D) H-DNA
E) single-stranded DNA

Question 43

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. $$\begin{array} { | l | r | r r r | r } \hline \text { Tube } & \text { A } & \mathbf { C } & \text { U } & \text { T } & \mathbf { G } \\\hline 1 & 32 & 17 & 0 & 32 & 19 \\\hline 2 & 34 & 16 & 15 & 0 & 35 \\\hline 3 & 30 & 21 & 0 & 26 & 23 \\\hline 4 & 33 & 16 & 34 & 0 & 17 \\\hline\end{array}$$

-Which samples would be destroyed by a DNase?

A) tubes 1 and 3
B) tubes 2 and 4
C) tubes 1 and 2
D) tubes 3 and 4
E) all the tubes

Question 44

Which of these sequences could form a hairpin?

A) 5'-GGGGTTTTCCCC-3'
B) 5'-AAAAAAAAAAAA-3'
C) 5'- AAAAGGCCCCCC -3'
D) 5'-TTTTTTCCCCCC-3'
E) 5'-GGGTTTGGGTTT-3'

Question 45

Which diagram shows a nucleotide that would be used to make RNA?

A) diagram A
B) diagram B
C) none of these diagrams
D) diagram D
E) diagram E

Question 46

Which diagram shows a nucleotide with a purine base?

A) diagram A
B) diagram B
C) diagram C
D) diagram D
E) diagram E

Question 47

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases?

A) 45
B) 100
C) 115
D) 135
E) 150

Question 48

In the following DNA molecule, how many hydrogen bonds are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

A) 24
B) 48
C) 58
D) 0
E) 3

Question 49

In the following DNA molecule, how many 3´ hydoxyls are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

A) 4
B) 2
C) 0
D) 24

Question 50

Which of the following chemical or structural characteristics of RNA is different from those of DNA? (Select all that apply.)

A) The RNA sugar is ribose instead of deoxyribose.
B) RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA.
C) The bases in RNA include uracil instead of thymine.
D) RNA molecules are generally shorter in length than those of DNA macromolecules.
E) The 2' carbon of ribose has an H, unlike the OH in that position of deoxyribose.

Question 51

Which of the following is NOT an example of secondary structure in nucleic acids?

A) hairpin
B) stem
C) H-DNA
D) B-DNA
E) C-DNA

Question 52

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. $$\begin{array} { | l |r |r |r |r | r |} \hline \text { Tube } & \text { A } & \mathbf { C } & \text { U } & \text { T } & \mathbf { G } \\\hline 1 & 32 & 17 & 0 & 32 & 19 \\\hline 2 & 34 & 16 & 15 & 0 & 35 \\\hline 3 & 30 & 21 & 0 & 26 & 23 \\\hline 4 & 33 & 16 & 34 & 0 & 17 \\\hline\end{array}$$

- Which tube MOST likely contains rotavirus?

A) tube 1
B) tube 2
C) tube 3
D) tube 4

Question 53

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. $$\begin{array} { | l | r | r r r | r } \hline \text { Tube } & \text { A } & \mathbf { C } & \text { U } & \text { T } & \mathbf { G } \\\hline 1 & 32 & 17 & 0 & 32 & 19 \\\hline 2 & 34 & 16 & 15 & 0 & 35 \\\hline 3 & 30 & 21 & 0 & 26 & 23 \\\hline 4 & 33 & 16 & 34 & 0 & 17 \\\hline\end{array}$$

-Which tube MOST likely contains mouse cytoplasm?

A) tube 1
B) tube 2
C) tube 3
D) tube 4

Question 54

Which diagram shows a nucleotide as it would appear in DNA?

A) diagram A
B) diagram B
C) diagram C
D) diagram D
E) diagram E

Question 55

In the following DNA molecule, how many purines are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

A) 23
B) 25
C) 48
D) 11

Question 56

In the following DNA molecule, how many ribose sugars are present? AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

A) 48
B) 24
C) 4
D) 2
E) 0

Question 57

Which of the following would NOT necessarily be true for a DNA molecule?

A) A = T
B) C = G
C) A + G = C + T
D) A + C = G + T
E) A + T = G + C

Question 58

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment?

A) diagram A
B) diagram B
C) diagram C
D) diagram D
E) diagram E

Question 59

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. $$\begin{array} { | l | r | r | r | r | r | } \hline \text { Tube } & \text { A } & \mathbf { C } & \mathbf { U } & \text { T } & \text { G } \\\hline 1 & 32 & 17 & 0 & 32 & 19 \\\hline 2 & 34 & 16 & 15 & 0 & 35 \\\hline 3 & 30 & 21 & 0 & 26 & 23 \\\hline 4 & 33 & 16 & 34 & 0 & 17 \\\hline\end{array}$$

- Which tube MOST likely contains parvovirus?

A) tube 1
B) tube 2
C) tube 3
D) tube 4

Question 60

You are a research assistant in a lab that studies nucleic acids. Your advisor gave you four tubes for analysis. Each of these tubes differs in its contents by the source of its nucleic acids: mouse cytoplasm (single-stranded RNA), yeast nuclei (double-stranded DNA), rotavirus (double-stranded RNA), and parvovirus (single-stranded DNA). The approximate nucleotide base composition of each sample is given in the table below. $$\begin{array} { | l r r r |r | r |} \hline \text { Tube } & \text { A } & \mathbf { C } & \text { U } & \text { T } & \mathbf { G } \\\hline 1 & 32 & 17 & 0 & 32 & 19 \\\hline 2 & 34 & 16 & 15 & 0 & 35 \\\hline 3 & 30 & 21 & 0 & 26 & 23 \\\hline 4 & 33 & 16 & 34 & 0 & 17 \\\hline\end{array}$$

- Which tube MOST likely contains yeast nuclei?

A) tube 1
B) tube 2
C) tube 3
D) tube 4

Question 61

List and briefly describe the three different secondary structures of DNA and discuss the physiological significance of each.

Question 62

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. Which nucleotide is MOST likely to be methylated?

A) A
B) T
C) C
D) G

Question 63

Draw the complementary strand to the following single-stranded DNA and label the 5' and 3'ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'.

Question 64

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template?
3'-TACCGTGCGTGACATTAAGCC-5'
Write the sequence from 5' to 3', left to right.

Question 65

While investigating a gene that might be responsible for pathogen resistance in the plant Arabidopsis, you discover that many of the nucleotides in the gene sequence are methylated. What might this methylation do to the expression of this gene?

A) nothing
B) increase
C) decrease

Question 66

In the diagram of a DNA molecule below, label the 5' and 3' ends of each strand; label a hydrogen bond; label a phosphodiester bond; label a purine; label a pyrimidine; label a deoxyribose sugar.

Question 67

You are a researcher studying the genetic basis of colon cancer. You have been working with a colon cancer cell line to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below). The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels. $$\begin{array} { | l r r | } \hline \text { Gene } & \text { Methylation levels } & \\\hline 1 & + + \\\hline 2 & + + + + + \\\hline 3 & + + + \\4 & + + \\5 & +\end{array}$$ Based on the information shown above, which gene would you predict to have the lowest rate of transcription?

A) gene 1
B) gene 2
C) gene 3
D) gene 4
E) gene 5

Question 68

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double stranded. How might these fragments differ to result in different denaturation temperatures?

Question 69

Draw a dinucleotide of two DNA molecules. Label the 5' end, the 3' end, and the phosphodiester bond. Draw the ring(s) of a purine base on one nucleotide and a pyrimidine base on the other. Then label them.

Question 70

Which secondary structure of DNA would MOST likely be seen in a dehydrated tissue sample?

A) A
B) B
C) Z
D) H

Question 71

In eukaryotic DNA, regions called "CpG islands" are often associated with unusual gene expression patterns, particularly decreased expression. What could be different about the DNA structure in these regions to account for decreased gene expression?

A) methylated cytosine
B) methylated guanine
C) methylated phosphate
D) a triple-stranded region

Question 72

Which DNA modification is the addition of a -CH3 group?

A) triple strand
B) methylation
C) looping
D) cytosine substitution
E) hydroxylation

Question 73

How many of each of the following does this DNA molecule have?
AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC
a. 3' hydroxyls
b. hydrogen bonds
c. purines
d. ribose sugars

Question 74

You are a researcher studying the genetic basis of colon cancer. You have been working with a colon cancer cell line to determine the expression levels of different genes that might contribute to cancer formation. You obtain the DNA methylation status of five genes of interest (the data are shown in the table below). The plus (+) sign indicates the level of DNA methylation; more plus signs correlates with increased methylation levels. $$\begin{array} { l r r } \hline \text { Gene } & \text { Methylation levels } & \\\hline 1 & + + \\\hline 2 & + + + + + \\\hline 3 & + + + \\4 & + + \\5 & +\end{array}$$ Based on the information shown above, which gene would you predict to have the highest rate of transcription?

A) gene 1
B) gene 2
C) gene 3
D) gene 4
E) gene 5

Question 75

Describe the secondary structure that DNA might form in an ancient, dehydrated tissue sample.

Question 76

List at least four errors in this drawing of two deoxyribonucleotides in a phosphodiester bond.

Question 77

Which secondary structure of DNA is typically left-handed?

A) A
B) B
C) Z
D) H

Question 78

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ to result in different denaturation temperatures?

A) Fragment A has a higher C+C content than fragment B.
B) Fragment B has a higher C+G content than fragment A.
C) Fragment A has a secondary structure of B form, while fragment B is an A form.
D) Fragment B is methylated more than fragment A.

Question 79

Describe two characteristics of Z-DNA that distinguish it from B-DNA.

Question 80

What would be the sequence of an RNA produced by using the DNA sequence shown as a template?
3'-TACCGTGCGTGACATTAAGCC-5'
Write the sequence from 5' to 3', left to right.