Deck 30: Protein Synthesis

Question 1

What Is the Genetic Code?

Answer 1

The genetic code refers to the sequence of RNA bases that code for a sequence of amino acid that makes up a protein. 3 RNA bases make up a codon which codes for a single amino acid. RNA has 4 different bases that can produce 64 different, 3 base combinations 3 codons are used for stop signals and the other 61 are used to code for the 20 amino acids that are found in proteins. Thus the genetic code is said to be universal, degenerate, and unambiguous.

Question 2

Translating nucleotide sequences into amino acid sequences
(Integrates with Chapter 12.) The following sequence represents part of the nucleotide sequence of a cloned cDNA:
... CAATACGAAGCAATCCCGCGACTAGACCTTAAC...
Can you reach an unambiguous conclusion from these data about the partial amino acid sequence of the protein encoded by this cDNA?

Answer 2

To make any conclusions about the cDNA strand we must first examine the sequence. After converting to its RNA form, we get the following strand.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
First thing is to determine a reading frame by looking for a start codon, AUG. There are no start codons in the sequence.
Next we look for stop codons: UGA, UAG, or UAA.
CAAUACGAAGCAAUCCCGCGAC UAG ACCU UAA C
We now can see that there are stop codons for 2 of the 3 possible reading frames. This means that the preceding codons, account for the C-terminal of the protein. The 3 rd reading frame would start with CAA and would not have a stop codon in the portion of the DNA sequence that we are provided.
More information would be required to determine which is the correct reading frame.

Question 3

How Is an Amino Acid Matched with Its Proper tRNA?

Answer 3

Aminoacyl-tRNAs will recognize the bases on the mRNA via its anticodon loop. Aminoacyl-tRNA synthase will interact with a 2 nd code of the aminoacyl-tRNA activating it to add the correct amino acid.
Recognition of a tRNA by Aminoacyl-tRNA synthase is different for each amino acid and there are no rules that govern their recognition. Some instances involve interactions with the anticodon loop and some do not.

Question 4

Nucleotide sequences, possible codons, and amino acid specification
A random (AG) copolymer was synthesized with polynucleotide phosphorylase using a mixture of 5 parts adenine nucleotide to one part guanine nucleotide as substrate. If this random copolymer is used in a cell-free protein synthesis system, which amino acids will be incorporated into the polypeptide product? What will be the relative abundances of these amino acids in the product?

Question 5

What Are the Rules in Codon-Anticodon Pairing?

Question 6

The second genetic code
Review the evidence establishing that aminoacyl-tRNA synthetases bridge the information gap between amino acids and codons. Indicate the various levels of specificity possessed by aminoacyltRNA synthetases that are essential for high-fidelity translation of messenger RNA molecules.

Question 7

What Is the Structure of Ribosomes, and How Are They Assembled?

Question 8

Codon-anticodon recognition: base-pairing possibilities
(Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair, (b) a C:G base pair, (c) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.

Question 9

What Are the Mechanics of mRNA Translation?

Question 10

Consequences of the wobble hypothesis
Point out why Crick's wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How does "wobble" tend to accelerate the rate of translation?

Question 11

How Are Proteins Synthesized in Eukaryotic Cells?

Question 12

Sense-to-nonsense codon mutations
How many codons can mutate to become nonsense codons through a single base change? Which amino acids do they encode?

Question 13

Amino acid possibilities in nonsense suppression
Nonsense suppression occurs when a suppressor mutant arises that reads a nonsense codon and inserts an amino acid, as if the nonsense codon was actually a sense codon. Which amino acids do you think are most likely to be incorporated by nonsense suppressor mutants?

Question 14

Prokaryotic vs. eukaryotic protein synthesis
Why do you suppose eukaryotic protein synthesis is only 10% as fast as prokaryotic protein synthesis?

Question 15

Capacity of the ribosomal peptide exit tunnel
If the tunnel through the large ribosomal subunit is 10 nm long, how many amino acid residues might be contained within it? (Assume that the growing polypeptide chain is in an extended ?-sheet- like conformation.)

Question 16

The consequences of ribosome complexity
Eukaryotic ribosomes are larger and more complex than prokaryotic ribosomes. What advantages and disadvantages might this greater ribosomal complexity bring to a eukaryotic cell?

Question 17

Ribosomes as two-subunit structures
What ideas can you suggest to explain why ribosomes invariably exist as two-subunit structures, instead of a larger, single-subunit entity?

Question 18

tRNAi Met recognition and translation initiation
How do prokaryotic cells determine whether a particular methionyl-tRNA Met is intended to initiate protein synthesis or to deliver a Met residue for internal incorporation into a polypeptide chain? How do the Met codons for these two different purposes differ? How do eukaryotic cells handle these problems?

Question 19

The function of the Shine-Dalgarno sequence
What is the Shine-Dalgarno sequence? What does it do? The efficiency of protein synthesis initiation may vary by as much as 100-fold for different mRNAs. How might the Shine-Dalgarno sequence be responsible for this difference?

Question 20

Reconciling peptide bond formation and tRNA movements
In the protein synthesis elongation events described under the section on translocation, which of the following seems the most apt account of the peptidyl transfer reaction: (a) The peptidyl-tRNA delivers its peptide chain to the newly arrived aminoacyl-tRNA situated in the A site, or (b) the aminoacyl end of the aminoacyl-tRNA moves toward the P site to accept the peptidyl chain? Which of these two scenarios makes most sense to you? Why?

Question 21

Why translation factors are G proteins
(Integrates with Chapter 15.) Why might you suspect that the elongation factors EF-Tu and EF-Ts are evolutionarily related to the G proteins of membrane signal transduction pathways described in Chapter 15?

Question 22

The energetic cost of peptide elongation
How many ATP equivalents are consumed for each amino acid added to an elongating polypeptide chain during the process of protein synthesis?

Question 23

Exploring the structure of the 30S ribosomal subunit
Go to www.pdb.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled "Biological Assembly", click "More Images…", and then scroll down to look at the Interactive View. By moving your cursor over the image, you can rotate it to view it from any perspective.
a. How are the ribosomal proteins represented in the image?
b. How is the 16S rRNA portrayed?
c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out?
d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?

Question 24

Exploring the structure of the 50S ribosomal subunit
Go back to www.pdb.org and bring up PDB file 1FFK, which shows the 50S ribosomal subunit. In the box titled "Biological Assembly," click "More Images," and scroll down to look at the Interactive View. Right-click the image to discover more information and tools.
a. How many atoms are represented in this structure?
b. Are the bases of the nucleotides visible anywhere in the structure?
c. Can you find double helical regions of RNA?
d. Right-click and, under "Select," select all proteins. Right-click again and select "Render," then "Scheme," and then "CPK Spacefill" to highlight the ribosomal proteins. Go back and cancel the protein selection. Then select "Nucleic," and render nucleic acid in "CPK Spacefill." Which macromolecular species seems to predominate the structure?

Question 25

Exploring the structure of the peptide chain termination complex
Go again to www.pdb.org and bring up the PDB file 3F1E. Scroll down and view the designations for the various components in the structure, as given in the Molecular Description box (note, for example, that the mRNA is designated "chain V"). In the box on the right click on "view in Jmol." View the overall structure, then scroll down below the Jmol box and under "PDP", click on the various 3F1E sections to highlight RF-2 in the Jmol image. Within the Jmol image, right click to explore the structure further. Clicking on "model 1/2" allows you to select the 30S or 50S subunits. Other possibilities allow you too delve further.

Question 26

Review the list of Shine-Dalgarno sequences in Figure 30.18 and select the one that will interact best with the 3'-end of E. coli 16S rRNA.

Question 27

Chloramphenicol (Figure 30.31) inhibits the peptidyl transferase activity of the 50S ribosomal subunit. The 50S peptidyl transferase active site consists solely of functionalities provided by the 23S rRNA. What sorts of interactions do you think take place when chloramphenicol binds to the peptidyl transferase center? Which groups on chloramphenicol might be involved in these interactions?