Deck 8: Gene Expression and Control
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Question
Unlock Deck
Sign up to unlock the cards in this deck!
Unlock Deck
Unlock Deck
1/86
Play
Full screen (f)
Deck 8: Gene Expression and Control
1
Transcription starts at a region of DNA called a(n) _____.
A) sequencer
B) promoter
C) activator
D) terminator
E) transcriber
A) sequencer
B) promoter
C) activator
D) terminator
E) transcriber
B
2
DNA molecules contain protein-coding sequences called _____.
A) genotypes
B) genomes
C) nucleotides
D) genes
E) ribonucleic acids
A) genotypes
B) genomes
C) nucleotides
D) genes
E) ribonucleic acids
D
3
Which process is responsible for the conversion of DNA information into messenger RNA?
A) replication
B) transcription
C) duplication
D) translation
E) synthesis
A) replication
B) transcription
C) duplication
D) translation
E) synthesis
B
4

A) translation; transcription
B) translation; transformation
C) transcription; translation
D) transcription; transformation
E) transformation; translation
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
5
Many ribosome-inactivating proteins are not toxic to humans because _____.
A) we have enzymes to detoxify them
B) they are very rare in nature
C) they are sequestered by white blood cells
D) they are rapidly metabolized
E) they do not cross cell membranes very well
A) we have enzymes to detoxify them
B) they are very rare in nature
C) they are sequestered by white blood cells
D) they are rapidly metabolized
E) they do not cross cell membranes very well
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
6
During transcription, _____.
A) noncoding sequences are removed from the RNA transcript
B) regulatory proteins attach to the DNA at the promoter site
C) DNA polymerase assembles RNA nucleotides
D) the entire DNA strand opens up for complete gene transcription
E) tRNA brings nucleotides to the DNA strand
A) noncoding sequences are removed from the RNA transcript
B) regulatory proteins attach to the DNA at the promoter site
C) DNA polymerase assembles RNA nucleotides
D) the entire DNA strand opens up for complete gene transcription
E) tRNA brings nucleotides to the DNA strand
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
7
Which of the following adds RNA nucleotides, one at a time, during transcription?
A) RNA polymerase
B) DNA polymerase
C) RNA nuclease
D) transfer RNA
E) ribosomal RNA
A) RNA polymerase
B) DNA polymerase
C) RNA nuclease
D) transfer RNA
E) ribosomal RNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
8
Ricin inactivates _____.
A) proteins
B) ribosomes
C) DNA
D) transcription factors
E) mRNA
A) proteins
B) ribosomes
C) DNA
D) transcription factors
E) mRNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
9
Ricin exerts its effects on a human cell by _____.
A) inactivating synthesis of carbohydrates
B) inhibiting hydrolysis of carbohydrates
C) preventing protein synthesis
D) interfering with hydrolysis of lipids
E) over activating nucleic acid metabolism
A) inactivating synthesis of carbohydrates
B) inhibiting hydrolysis of carbohydrates
C) preventing protein synthesis
D) interfering with hydrolysis of lipids
E) over activating nucleic acid metabolism
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
10

In this representation of transcription, strand # ____ is ____ because it ____.
A) 2; RNA; is double-stranded
B) 3; RNA; contains uracil
C) 2; RNA; contains thymine
D) 2; RNA; has no uracil
E) 3; DNA; contains adenine
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
11
Which of the following processes is/are part of gene expression? I. transduction
II) transcription
III) translation
A) I and II
B) I and III
C) II and III
D) I, II, and III
E) III only
II) transcription
III) translation
A) I and II
B) I and III
C) II and III
D) I, II, and III
E) III only
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
12
The information from messenger RNA is used to create polypeptide sequences during the process of _____.
A) transduction
B) transcription
C) transformation
D) translation
E) replication
A) transduction
B) transcription
C) transformation
D) translation
E) replication
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
13
Amino acids are carried to ribosomes by____ RNA.
A) template
B) messenger
C) transfer
D) ribosomal
E) retriever
A) template
B) messenger
C) transfer
D) ribosomal
E) retriever
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
14
The toxicity of ricin has been known since ____.
A) 1588
B) 1688
C) 1788
D) 1888
E) 1988
A) 1588
B) 1688
C) 1788
D) 1888
E) 1988
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
15
In eukaryotes, DNA is transcribed in the _____.
A) mitochondria
B) cytoplasm
C) ribosomes
D) nucleus
E) endoplasmic reticulum
A) mitochondria
B) cytoplasm
C) ribosomes
D) nucleus
E) endoplasmic reticulum
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
16
Ricin is a toxin found in _____.
A) canola-oil seeds
B) castor-oil seeds
C) gypsum-weed seeds
D) sesame seeds
E) sunflower seeds
A) canola-oil seeds
B) castor-oil seeds
C) gypsum-weed seeds
D) sesame seeds
E) sunflower seeds
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
17
A gene is a DNA sequence that codes for a protein or _____ product.
A) RNA
B) DNA
C) ribosome
D) lipid
E) exon
A) RNA
B) DNA
C) ribosome
D) lipid
E) exon
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
18
Which type of molecule is ricin?
A) protein
B) lipid
C) nucleic acid
D) carbohydrate
E) mineral
A) protein
B) lipid
C) nucleic acid
D) carbohydrate
E) mineral
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
19
The type of RNA that carries protein-building information is called _____.
A) ribosomal RNA
B) transfer RNA
C) messenger RNA
D) reader RNA
E) translator RNA
A) ribosomal RNA
B) transfer RNA
C) messenger RNA
D) reader RNA
E) translator RNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
20
Transcription _____.
A) uses both strands of DNA simultaneously as templates
B) uses the enzyme DNA polymerase
C) results in a double-stranded end product
D) produces three different types of RNA molecules
E) does not require the hydrogen bonds of DNA to be broken
A) uses both strands of DNA simultaneously as templates
B) uses the enzyme DNA polymerase
C) results in a double-stranded end product
D) produces three different types of RNA molecules
E) does not require the hydrogen bonds of DNA to be broken
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
21
What is the genetic code?
A) all of our genes collectively
B) all of our base pairs collectively
C) the genetic "words" that code for amino acids
D) the genes in DNA that code for proteins
E) the genes that encode protein products
A) all of our genes collectively
B) all of our base pairs collectively
C) the genetic "words" that code for amino acids
D) the genes in DNA that code for proteins
E) the genes that encode protein products
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
22
How many different codons are part of the genetic code?
A) 4
B) 16
C) 32
D) 64
E) 128
A) 4
B) 16
C) 32
D) 64
E) 128
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
23
How many codons specify the amino acid leucine?
A) two
B) three
C) four
D) five
E) six
A) two
B) three
C) four
D) five
E) six
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
24
Which enzyme unwinds the DNA during transcription?
A) helicase
B) DNA polymerase
C) DNA replicase
D) RNA polymerase
E) RNA replicase
A) helicase
B) DNA polymerase
C) DNA replicase
D) RNA polymerase
E) RNA replicase
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
25
Eukaryotic post-transcriptional modifications occur in the _____.
A) cytoplasm
B) mitochondria
C) nucleus
D) ribosome
E) endoplasmic reticulum
A) cytoplasm
B) mitochondria
C) nucleus
D) ribosome
E) endoplasmic reticulum
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
26
In prokaryotes, transcription occurs in the _____.
A) mitochondria
B) cytoplasm
C) ribosomes
D) nucleus
E) endoplasmic reticulum
A) mitochondria
B) cytoplasm
C) ribosomes
D) nucleus
E) endoplasmic reticulum
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
27
What are the noncoding segments of DNA called?
A) introns
B) exons
C) promoters
D) transcription factors
E) knockouts
A) introns
B) exons
C) promoters
D) transcription factors
E) knockouts
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
28
During transcription, adenine is complementary to _____.
A) guanine
B) adenine
C) cytosine
D) uracil
E) guanine and cytosine
A) guanine
B) adenine
C) cytosine
D) uracil
E) guanine and cytosine
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
29

Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?
A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
30
Which of the following carries amino acids to ribosomes?
A) mRNA
B) tRNA
C) hnRNA
D) rRNA
E) all of these
A) mRNA
B) tRNA
C) hnRNA
D) rRNA
E) all of these
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
31
tRNA differs from other types of RNA because it _____.
A) acts as an enzyme
B) is only involved in transcription
C) binds to mRNA
D) codes for multiple amino acids
E) is complexed with a protein
A) acts as an enzyme
B) is only involved in transcription
C) binds to mRNA
D) codes for multiple amino acids
E) is complexed with a protein
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
32
Which nucleotide is added to the end of a completed messenger RNA transcript?
A) adenine
B) thymine
C) cytosine
D) guanine
E) alternating adenine and thymine
A) adenine
B) thymine
C) cytosine
D) guanine
E) alternating adenine and thymine
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
33
What does it mean that the genetic code is "highly conserved"?
A) I t is almost universal and has not changed in millions of years.
B) I t resists modification from environmental mutagens.
C) O rganisms can only use it a certain number of times.
D) All organisms and organelles-without exception-have the exact same genetic code.
E) The products of the genetic code-proteins-are almost the same in all organisms.
A) I t is almost universal and has not changed in millions of years.
B) I t resists modification from environmental mutagens.
C) O rganisms can only use it a certain number of times.
D) All organisms and organelles-without exception-have the exact same genetic code.
E) The products of the genetic code-proteins-are almost the same in all organisms.
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
34
How many nucleotides comprise one codon?
A) 2
B) 3
C) 5
D) 6
E) 16
A) 2
B) 3
C) 5
D) 6
E) 16
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
35
In most species, all mRNA transcripts begin with _____.
A) methionine
B) a ribosome
C) AUG
D) the P site
E) an anticodon
A) methionine
B) a ribosome
C) AUG
D) the P site
E) an anticodon
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
36
A ribosome contains _____.
A) RNA only
B) DNA only
C) proteins only
D) RNA and proteins
E) RNA, DNA, and proteins
A) RNA only
B) DNA only
C) proteins only
D) RNA and proteins
E) RNA, DNA, and proteins
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
37
How many different codons in our genetic code specify amino acids?
A) 3
B) 20
C) 60
D) 61
E) 64
A) 3
B) 20
C) 60
D) 61
E) 64
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
38
If the codon consisted of only 2 nucleotides, _____ codons would be possible.
A) 4
B) 8
C) 16
D) 32
E) 64
A) 4
B) 8
C) 16
D) 32
E) 64
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
39

Referring to the given image, what is the most likely sequence of DNA that codes for the amino acid sequence asn-tyr-phe-ser-pro?
A) AACTATAAATCACCA
B) GGGCCATGTAAACTA
C) CUUAUAAAAAGUUGA
D) TTGATAAAAAGTGGT
E) TTGATCGGAAGTTGA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
40
How many different amino acids are found in humans?
A) 4
B) 8
C) 12
D) 16
E) 20
A) 4
B) 8
C) 12
D) 16
E) 20
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
41
Which mutation(s) may not result in an amino acid change in the protein product?
A) deletion and insertion
B) deletion and substitution
C) insertion and substitution
D) substitution only
E) insertion only
A) deletion and insertion
B) deletion and substitution
C) insertion and substitution
D) substitution only
E) insertion only
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
42
Why are mutations uncommon in normal cells?
A) Only 25 percent of the genome codes for proteins; therefore, the probability is low that a mutation would occur in a protein-coding region.
B) Most mutations occur after DNA replication.
C) Many amino acids are coded for by more than one codon.
D) The mutation rate during DNA replication is 1 in 100 nucleotides.
E) The mutation rate during DNA replication is zero.
A) Only 25 percent of the genome codes for proteins; therefore, the probability is low that a mutation would occur in a protein-coding region.
B) Most mutations occur after DNA replication.
C) Many amino acids are coded for by more than one codon.
D) The mutation rate during DNA replication is 1 in 100 nucleotides.
E) The mutation rate during DNA replication is zero.
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
43
During elongation, ribosomes catalyze formation of a ____ bond between an amino acid and the growing polypeptide.
A) hydrogen
B) peptide
C) polar covalent
D) nonpolar covalent
E) sulfur
A) hydrogen
B) peptide
C) polar covalent
D) nonpolar covalent
E) sulfur
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
44
As the polypeptide is elongating during translation, what is the ribosome doing?
A) removing incorrectly added amino acids
B) moving along the mRNA transcript bonding amino acids to each other
C) travelling back and forth between the nucleus and the growing polypeptide with information on which amino acids to add
D) removing the noncoding introns
E) breaking hydrogen bonds between the tRNA and the mRNA
A) removing incorrectly added amino acids
B) moving along the mRNA transcript bonding amino acids to each other
C) travelling back and forth between the nucleus and the growing polypeptide with information on which amino acids to add
D) removing the noncoding introns
E) breaking hydrogen bonds between the tRNA and the mRNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
45
Translation stops when _____.
A) enzymes attach to the mRNA molecule at the end of the transcript
B) a certain number of codons have been read
C) one of the three stop codons is encountered
D) the cell runs out of tRNA
E) stop codon tRNAs add guanine caps to the newly formed peptide
A) enzymes attach to the mRNA molecule at the end of the transcript
B) a certain number of codons have been read
C) one of the three stop codons is encountered
D) the cell runs out of tRNA
E) stop codon tRNAs add guanine caps to the newly formed peptide
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
46
What is the maximum number of different tRNAs in a eukaryotic cell?
A) 3
B) 20
C) 60
D) 61
E) 64
A) 3
B) 20
C) 60
D) 61
E) 64
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
47
Ribosome inactivating proteins (RIPs) inhibit protein synthesis by preventing _____.
A) mRNA from binding to the ribosome
B) tRNA from binding to the ribosome
C) the two halves of the ribosome from coming together
D) the ribosome from moving forward from one codon to the next
E) the newly synthesized amino acid chain from being released from the ribosome
A) mRNA from binding to the ribosome
B) tRNA from binding to the ribosome
C) the two halves of the ribosome from coming together
D) the ribosome from moving forward from one codon to the next
E) the newly synthesized amino acid chain from being released from the ribosome
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
48
The first amino acid in a growing polypeptide chain is _____.
A) methionine
B) valine
C) lysine
D) phenylalanine
E) glycine
A) methionine
B) valine
C) lysine
D) phenylalanine
E) glycine
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
49
How much of the human genome actually codes for protein products?
A) 2 percent
B) 26 percent
C) 48 percent
D) 71 percent
E) 100 percent
A) 2 percent
B) 26 percent
C) 48 percent
D) 71 percent
E) 100 percent
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
50
Frameshift mutations may involve _____.
A) the substitution of nucleotides
B) the substitution of codons
C) the substitution of amino acids
D) the insertion of one to several base pairs
E) mutations in the promoter
A) the substitution of nucleotides
B) the substitution of codons
C) the substitution of amino acids
D) the insertion of one to several base pairs
E) mutations in the promoter
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
51
What is at the center of a heme molecule in a hemoglobin protein?
A) a beta globin chain
B) an alpha globin chain
C) iron
D) nitrogen
E) another heme molecule
A) a beta globin chain
B) an alpha globin chain
C) iron
D) nitrogen
E) another heme molecule
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
52
The activity of the ribosome in translation is analogous to a(n) _____.
A) assembly line
B) dance
C) planet racing around the sun
D) foot race
E) chess game
A) assembly line
B) dance
C) planet racing around the sun
D) foot race
E) chess game
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
53
Which type of mutation results in sickle-cell anemia?
A) base-pair substitution
B) insertion
C) deletion
D) frameshift
E) gene duplication
A) base-pair substitution
B) insertion
C) deletion
D) frameshift
E) gene duplication
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
54
For eukaryotes, translation takes place in the _____.
A) nucleus
B) nucleolus
C) cytoplasm
D) plasma membrane
E) nucleus and cytoplasm
A) nucleus
B) nucleolus
C) cytoplasm
D) plasma membrane
E) nucleus and cytoplasm
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
55
Most of the energy required to form the peptide bonds during elongation comes from _____.
A) ATP
B) CTP
C) GTP
D) TTP
E) whichever nucleotide is at the front of the codon
A) ATP
B) CTP
C) GTP
D) TTP
E) whichever nucleotide is at the front of the codon
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
56
Which RNA acts as an enzyme?
A) mRNA
B) rRNA
C) tRNA
D) mRNA and rRNA
E) rRNA and tRNA
A) mRNA
B) rRNA
C) tRNA
D) mRNA and rRNA
E) rRNA and tRNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
57
The difference between normal and sickle-cell hemoglobin is _____.
A) the number of amino acids in the molecule
B) the substitution of one amino acid for another
C) the number and orientation of the amino acid chains attached to the heme portion of the molecule
D) the number of oxygen molecules that can be carried
E) the types of blood cells that produce each protein
A) the number of amino acids in the molecule
B) the substitution of one amino acid for another
C) the number and orientation of the amino acid chains attached to the heme portion of the molecule
D) the number of oxygen molecules that can be carried
E) the types of blood cells that produce each protein
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
58
Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA, what happens to that first tRNA?
A) I t remains attached to the rRNA.
B) I t moves into the nucleus to get more instructions from mRNA.
C) I t breaks down into its component nucleotides.
D) I t leaves the ribosome and may pick up another amino acid.
E) I t transforms into an mRNA molecule.
A) I t remains attached to the rRNA.
B) I t moves into the nucleus to get more instructions from mRNA.
C) I t breaks down into its component nucleotides.
D) I t leaves the ribosome and may pick up another amino acid.
E) I t transforms into an mRNA molecule.
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
59
What is an anticodon?
A) the region of DNA that codes for the codon
B) the region of DNA that base-pairs with the codon
C) the region of the mRNA that codes for an amino acid
D) the region of the mRNA that base-pairs with the tRNA
E) the region of the tRNA that base-pairs with the mRNA
A) the region of DNA that codes for the codon
B) the region of DNA that base-pairs with the codon
C) the region of the mRNA that codes for an amino acid
D) the region of the mRNA that base-pairs with the tRNA
E) the region of the tRNA that base-pairs with the mRNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
60
In prokaryotes, translation takes place in the _____.
A) cytoplasm
B) nucleus
C) plasma membrane
D) endoplasmic reticulum
E) Golgi bodies
A) cytoplasm
B) nucleus
C) plasma membrane
D) endoplasmic reticulum
E) Golgi bodies
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
61
In a sickled red blood cell, what do the hemoglobin molecules do?
A) repel each other
B) stick together
C) fracture and release their contents into the cytoplasm
D) create holes in the cell membrane
E) hold less tightly onto oxygen molecules
A) repel each other
B) stick together
C) fracture and release their contents into the cytoplasm
D) create holes in the cell membrane
E) hold less tightly onto oxygen molecules
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
62
Sphynx cats have a mutation in a(n)_____ of the keratin gene, which prevents necessary splicing; therefore, keratin protein fibers do not assemble properly.
A) promoter
B) intron-exon splice site
C) exon
D) stop codon
E) enhancer
A) promoter
B) intron-exon splice site
C) exon
D) stop codon
E) enhancer
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
63
Transcription factors bind to _____.
A) promoters
B) stop codons
C) start codons
D) poly(A) tails
E) introns
A) promoters
B) stop codons
C) start codons
D) poly(A) tails
E) introns
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
64
Proteins that regulate gene expression by directly binding to the DNA are known as _____.
A) transcription factors
B) translation factors
C) transposable elements
D) methylation
E) phosphorylation
A) transcription factors
B) translation factors
C) transposable elements
D) methylation
E) phosphorylation
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
65
A Barr body exists for the purpose of _____.
A) gene dosage compensation
B) insuring fertilization
C) blocking the activity of the Y chromosome
D) turning on the SRY gene
E) activating master genes
A) gene dosage compensation
B) insuring fertilization
C) blocking the activity of the Y chromosome
D) turning on the SRY gene
E) activating master genes
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
66
Mutations in an intron region of a gene are most likely to _____.
A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) result in no changes in the amino acid sequence
E) alter the amino acid sequence
A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) result in no changes in the amino acid sequence
E) alter the amino acid sequence
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
67
Which types of cells are most likely to have high levels of methyl groups in their DNA?
A) embryonic cells
B) blastocyst cells
C) senescent cells (cells that are not actively dividing)
D) apoptotic cells (cells that are undergoing cell death)
E) rapidly dividing cells
A) embryonic cells
B) blastocyst cells
C) senescent cells (cells that are not actively dividing)
D) apoptotic cells (cells that are undergoing cell death)
E) rapidly dividing cells
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
68
Epigenetics is most closely associated with _____.
A) base-pair substitution
B) methylation
C) Barr bodies
D) hydrolysis
E) phosphorylation
A) base-pair substitution
B) methylation
C) Barr bodies
D) hydrolysis
E) phosphorylation
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
69
In sickle-cell anemia, what happens to the hemoglobin molecule that causes the red blood cell to sickle?
A) A small part of it becomes hydrophobic.
B) A small part of it becomes hydrophilic.
C) A small part of it becomes polar.
D) A small part of it becomes negatively charged.
E) A small part of it becomes positively charged.
A) A small part of it becomes hydrophobic.
B) A small part of it becomes hydrophilic.
C) A small part of it becomes polar.
D) A small part of it becomes negatively charged.
E) A small part of it becomes positively charged.
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
70
Mutations in promoter regions of a gene are most likely to _____.
A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) prevent mRNA from being post-transcriptionally modified
E) alter the amino acid sequence
A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) prevent mRNA from being post-transcriptionally modified
E) alter the amino acid sequence
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
71
Heritable changes in gene expression not due to changes in DNA sequences are known as _____.
A) epigenetics
B) methylation
C) translational mutation
D) differentiation
E) frameshift inheritance
A) epigenetics
B) methylation
C) translational mutation
D) differentiation
E) frameshift inheritance
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
72
Which molecule initiates translation after an egg is fertilized?
A) maternal mRNA
B) paternal promoters in sperm
C) maternal transcription factors
D) transposable elements
E) paternal DNA
A) maternal mRNA
B) paternal promoters in sperm
C) maternal transcription factors
D) transposable elements
E) paternal DNA
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
73
The master gene that controls eye development in all multicellular eukaryotes is an example of a(n) _____.
A) homeotic gene
B) conserved protein
C) RNA enzyme
D) Barr body
E) translation factor
A) homeotic gene
B) conserved protein
C) RNA enzyme
D) Barr body
E) translation factor
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
74
Mutations in an exon region of a gene are most likely to _____.
A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) prevent mRNA from being post-transcriptionally modified
E) alter the amino acid sequence
A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) prevent mRNA from being post-transcriptionally modified
E) alter the amino acid sequence
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
75
Mutations at intron-exon splice sites in DNA can lead to a(n) _____.
A) short or truncated protein
B) protein that has a change in polarity
C) change in hydrophobicity
D) unspliced mRNA
E) mRNA that cannot be translated
A) short or truncated protein
B) protein that has a change in polarity
C) change in hydrophobicity
D) unspliced mRNA
E) mRNA that cannot be translated
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
76
Methylation of histone proteins promotes _____.
A) transcription
B) translation
C) binding of transcription factors
D) condensation of DNA
E) differentiation
A) transcription
B) translation
C) binding of transcription factors
D) condensation of DNA
E) differentiation
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
77
In mammals, X chromosome inactivation results in _____.
A) a total inactivation of both female X chromosomes
B) only the inactivation of the paternal X chromosome in females
C) only the inactivation of the maternal X chromosome in females
D) the random inactivation of either the paternal or the maternal X in females
E) the inactivation of the maternal X chromosome in males
A) a total inactivation of both female X chromosomes
B) only the inactivation of the paternal X chromosome in females
C) only the inactivation of the maternal X chromosome in females
D) the random inactivation of either the paternal or the maternal X in females
E) the inactivation of the maternal X chromosome in males
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
78
Homeotic genes are, in general, in control of _____.
A) X chromosome inactivation
B) formation of major body parts
C) methylation of nucleotides
D) dosage compensation
E) sex determination
A) X chromosome inactivation
B) formation of major body parts
C) methylation of nucleotides
D) dosage compensation
E) sex determination
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
79
The master gene for male sex determination is located on _____.
A) both X chromosomes
B) each autosome
C) the Y chromosome
D) the X chromosome
E) both X and Y chromosomes
A) both X chromosomes
B) each autosome
C) the Y chromosome
D) the X chromosome
E) both X and Y chromosomes
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck
80
The tightly condensed nonfunctional X chromosome is called a(n) _____.
A) Barr body
B) Y chromosome
C) autosome
D) X-linked chromosome
E) Watson segment
A) Barr body
B) Y chromosome
C) autosome
D) X-linked chromosome
E) Watson segment
Unlock Deck
Unlock for access to all 86 flashcards in this deck.
Unlock Deck
k this deck