Deck 8: Gene Expression and Control

Question 1

Transcription starts at a region of DNA called a(n) _____.

A) sequencer
B) promoter
C) activator
D) terminator
E) transcriber

Answer 1

B

Question 2

DNA molecules contain protein-coding sequences called _____.

A) genotypes
B) genomes
C) nucleotides
D) genes
E) ribonucleic acids

Answer 2

D

Question 3

Which process is responsible for the conversion of DNA information into messenger RNA?

A) replication
B) transcription
C) duplication
D) translation
E) synthesis

Answer 3

B

Question 4

In the given figure, the process indicated by number 1 is _____, while the process indicated by number 2 is _____.

A) translation; transcription
B) translation; transformation
C) transcription; translation
D) transcription; transformation
E) transformation; translation

Question 5

Many ribosome-inactivating proteins are not toxic to humans because _____.

A) we have enzymes to detoxify them
B) they are very rare in nature
C) they are sequestered by white blood cells
D) they are rapidly metabolized
E) they do not cross cell membranes very well

Question 6

During transcription, _____.

A) noncoding sequences are removed from the RNA transcript
B) regulatory proteins attach to the DNA at the promoter site
C) DNA polymerase assembles RNA nucleotides
D) the entire DNA strand opens up for complete gene transcription
E) tRNA brings nucleotides to the DNA strand

Question 7

Which of the following adds RNA nucleotides, one at a time, during transcription?

A) RNA polymerase
B) DNA polymerase
C) RNA nuclease
D) transfer RNA
E) ribosomal RNA

Question 8

Ricin inactivates _____.

A) proteins
B) ribosomes
C) DNA
D) transcription factors
E) mRNA

Question 9

Ricin exerts its effects on a human cell by _____.

A) inactivating synthesis of carbohydrates
B) inhibiting hydrolysis of carbohydrates
C) preventing protein synthesis
D) interfering with hydrolysis of lipids
E) over activating nucleic acid metabolism

Question 10

 
In this representation of transcription, strand # ____ is ____ because it ____.

A) 2; RNA; is double-stranded
B) 3; RNA; contains uracil
C) 2; RNA; contains thymine
D) 2; RNA; has no uracil
E) 3; DNA; contains adenine

Question 11

Which of the following processes is/are part of gene expression? I. transduction
II) transcription
III) translation

A) I and II
B) I and III
C) II and III
D) I, II, and III
E) III only

Question 12

The information from messenger RNA is used to create polypeptide sequences during the process of _____.

A) transduction
B) transcription
C) transformation
D) translation
E) replication

Question 13

Amino acids are carried to ribosomes by____ RNA.

A) template
B) messenger
C) transfer
D) ribosomal
E) retriever

Question 14

The toxicity of ricin has been known since ____.

A) 1588
B) 1688
C) 1788
D) 1888
E) 1988

Question 15

In eukaryotes, DNA is transcribed in the _____.

A) mitochondria
B) cytoplasm
C) ribosomes
D) nucleus
E) endoplasmic reticulum

Question 16

Ricin is a toxin found in _____.

A) canola-oil seeds
B) castor-oil seeds
C) gypsum-weed seeds
D) sesame seeds
E) sunflower seeds

Question 17

A gene is a DNA sequence that codes for a protein or _____ product.

A) RNA
B) DNA
C) ribosome
D) lipid
E) exon

Question 18

Which type of molecule is ricin?

A) protein
B) lipid
C) nucleic acid
D) carbohydrate
E) mineral

Question 19

The type of RNA that carries protein-building information is called _____.

A) ribosomal RNA
B) transfer RNA
C) messenger RNA
D) reader RNA
E) translator RNA

Question 20

Transcription _____.

A) uses both strands of DNA simultaneously as templates
B) uses the enzyme DNA polymerase
C) results in a double-stranded end product
D) produces three different types of RNA molecules
E) does not require the hydrogen bonds of DNA to be broken

Question 21

What is the genetic code?

A) all of our genes collectively
B) all of our base pairs collectively
C) the genetic "words" that code for amino acids
D) the genes in DNA that code for proteins
E) the genes that encode protein products

Question 22

How many different codons are part of the genetic code?

A) 4
B) 16
C) 32
D) 64
E) 128

Question 23

How many codons specify the amino acid leucine?

A) two
B) three
C) four
D) five
E) six

Question 24

Which enzyme unwinds the DNA during transcription?

A) helicase
B) DNA polymerase
C) DNA replicase
D) RNA polymerase
E) RNA replicase

Question 25

Eukaryotic post-transcriptional modifications occur in the _____.

A) cytoplasm
B) mitochondria
C) nucleus
D) ribosome
E) endoplasmic reticulum

Question 26

In prokaryotes, transcription occurs in the _____.

A) mitochondria
B) cytoplasm
C) ribosomes
D) nucleus
E) endoplasmic reticulum

Question 27

What are the noncoding segments of DNA called?

A) introns
B) exons
C) promoters
D) transcription factors
E) knockouts

Question 28

During transcription, adenine is complementary to _____.

A) guanine
B) adenine
C) cytosine
D) uracil
E) guanine and cytosine

Question 29

 
Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop

Question 30

Which of the following carries amino acids to ribosomes?

A) mRNA
B) tRNA
C) hnRNA
D) rRNA
E) all of these

Question 31

tRNA differs from other types of RNA because it _____.

A) acts as an enzyme
B) is only involved in transcription
C) binds to mRNA
D) codes for multiple amino acids
E) is complexed with a protein

Question 32

Which nucleotide is added to the end of a completed messenger RNA transcript?

A) adenine
B) thymine
C) cytosine
D) guanine
E) alternating adenine and thymine

Question 33

What does it mean that the genetic code is "highly conserved"?

A) I t is almost universal and has not changed in millions of years.
B) I t resists modification from environmental mutagens.
C) O rganisms can only use it a certain number of times.
D) All organisms and organelles-without exception-have the exact same genetic code.
E) The products of the genetic code-proteins-are almost the same in all organisms.

Question 34

How many nucleotides comprise one codon?

A) 2
B) 3
C) 5
D) 6
E) 16

Question 35

In most species, all mRNA transcripts begin with _____.

A) methionine
B) a ribosome
C) AUG
D) the P site
E) an anticodon

Question 36

A ribosome contains _____.

A) RNA only
B) DNA only
C) proteins only
D) RNA and proteins
E) RNA, DNA, and proteins

Question 37

How many different codons in our genetic code specify amino acids?

A) 3
B) 20
C) 60
D) 61
E) 64

Question 38

If the codon consisted of only 2 nucleotides, _____ codons would be possible.

A) 4
B) 8
C) 16
D) 32
E) 64

Question 39

 
Referring to the given image, what is the most likely sequence of DNA that codes for the amino acid sequence asn-tyr-phe-ser-pro?

A) AACTATAAATCACCA
B) GGGCCATGTAAACTA
C) CUUAUAAAAAGUUGA
D) TTGATAAAAAGTGGT
E) TTGATCGGAAGTTGA

Question 40

How many different amino acids are found in humans?

A) 4
B) 8
C) 12
D) 16
E) 20

Question 41

Which mutation(s) may not result in an amino acid change in the protein product?

A) deletion and insertion
B) deletion and substitution
C) insertion and substitution
D) substitution only
E) insertion only

Question 42

Why are mutations uncommon in normal cells?

A) Only 25 percent of the genome codes for proteins; therefore, the probability is low that a mutation would occur in a protein-coding region.
B) Most mutations occur after DNA replication.
C) Many amino acids are coded for by more than one codon.
D) The mutation rate during DNA replication is 1 in 100 nucleotides.
E) The mutation rate during DNA replication is zero.

Question 43

During elongation, ribosomes catalyze formation of a ____ bond between an amino acid and the growing polypeptide.

A) hydrogen
B) peptide
C) polar covalent
D) nonpolar covalent
E) sulfur

Question 44

As the polypeptide is elongating during translation, what is the ribosome doing?

A) removing incorrectly added amino acids
B) moving along the mRNA transcript bonding amino acids to each other
C) travelling back and forth between the nucleus and the growing polypeptide with information on which amino acids to add
D) removing the noncoding introns
E) breaking hydrogen bonds between the tRNA and the mRNA

Question 45

Translation stops when _____.

A) enzymes attach to the mRNA molecule at the end of the transcript
B) a certain number of codons have been read
C) one of the three stop codons is encountered
D) the cell runs out of tRNA
E) stop codon tRNAs add guanine caps to the newly formed peptide

Question 46

What is the maximum number of different tRNAs in a eukaryotic cell?

A) 3
B) 20
C) 60
D) 61
E) 64

Question 47

Ribosome inactivating proteins (RIPs) inhibit protein synthesis by preventing _____.

A) mRNA from binding to the ribosome
B) tRNA from binding to the ribosome
C) the two halves of the ribosome from coming together
D) the ribosome from moving forward from one codon to the next
E) the newly synthesized amino acid chain from being released from the ribosome

Question 48

The first amino acid in a growing polypeptide chain is _____.

A) methionine
B) valine
C) lysine
D) phenylalanine
E) glycine

Question 49

How much of the human genome actually codes for protein products?

A) 2  percent
B) 26  percent
C) 48  percent
D) 71  percent
E) 100  percent

Question 50

Frameshift mutations may involve _____.

A) the substitution of nucleotides
B) the substitution of codons
C) the substitution of amino acids
D) the insertion of one to several base pairs
E) mutations in the promoter

Question 51

What is at the center of a heme molecule in a hemoglobin protein?

A) a beta globin chain
B) an alpha globin chain
C) iron
D) nitrogen
E) another heme molecule

Question 52

The activity of the ribosome in translation is analogous to a(n) _____.

A) assembly line
B) dance
C) planet racing around the sun
D) foot race
E) chess game

Question 53

Which type of mutation results in sickle-cell anemia?

A) base-pair substitution
B) insertion
C) deletion
D) frameshift
E) gene duplication

Question 54

For eukaryotes, translation takes place in the _____.

A) nucleus
B) nucleolus
C) cytoplasm
D) plasma membrane
E) nucleus and cytoplasm

Question 55

Most of the energy required to form the peptide bonds during elongation comes from _____.

A) ATP
B) CTP
C) GTP
D) TTP
E) whichever nucleotide is at the front of the codon

Question 56

Which RNA acts as an enzyme?

A) mRNA
B) rRNA
C) tRNA
D) mRNA and rRNA
E) rRNA and tRNA

Question 57

The difference between normal and sickle-cell hemoglobin is _____.

A) the number of amino acids in the molecule
B) the substitution of one amino acid for another
C) the number and orientation of the amino acid chains attached to the heme portion of the molecule
D) the number of oxygen molecules that can be carried
E) the types of blood cells that produce each protein

Question 58

Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA, what happens to that first tRNA?

A) I t remains attached to the rRNA.
B) I t moves into the nucleus to get more instructions from mRNA.
C) I t breaks down into its component nucleotides.
D) I t leaves the ribosome and may pick up another amino acid.
E) I t transforms into an mRNA molecule.

Question 59

What is an anticodon?

A) the region of DNA that codes for the codon
B) the region of DNA that base-pairs with the codon
C) the region of the mRNA that codes for an amino acid
D) the region of the mRNA that base-pairs with the tRNA
E) the region of the tRNA that base-pairs with the mRNA

Question 60

In prokaryotes, translation takes place in the _____.

A) cytoplasm
B) nucleus
C) plasma membrane
D) endoplasmic reticulum
E) Golgi bodies

Question 61

In a sickled red blood cell, what do the hemoglobin molecules do?

A) repel each other
B) stick together
C) fracture and release their contents into the cytoplasm
D) create holes in the cell membrane
E) hold less tightly onto oxygen molecules

Question 62

Sphynx cats have a mutation in a(n)_____ of the keratin gene, which prevents necessary splicing; therefore, keratin protein fibers do not assemble properly.

A) promoter
B) intron-exon splice site
C) exon
D) stop codon
E) enhancer

Question 63

Transcription factors bind to _____.

A) promoters
B) stop codons
C) start codons
D) poly(A) tails
E) introns

Question 64

Proteins that regulate gene expression by directly binding to the DNA are known as _____.

A) transcription factors
B) translation factors
C) transposable elements
D) methylation
E) phosphorylation

Question 65

A Barr body exists for the purpose of _____.

A) gene dosage compensation
B) insuring fertilization
C) blocking the activity of the Y chromosome
D) turning on the SRY gene
E) activating master genes

Question 66

Mutations in an intron region of a gene are most likely to _____.

A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) result in no changes in the amino acid sequence
E) alter the amino acid sequence

Question 67

Which types of cells are most likely to have high levels of methyl groups in their DNA?

A) embryonic cells
B) blastocyst cells
C) senescent cells (cells that are not actively dividing)
D) apoptotic cells (cells that are undergoing cell death)
E) rapidly dividing cells

Question 68

Epigenetics is most closely associated with _____.

A) base-pair substitution
B) methylation
C) Barr bodies
D) hydrolysis
E) phosphorylation

Question 69

In sickle-cell anemia, what happens to the hemoglobin molecule that causes the red blood cell to sickle?

A) A  small part of it becomes hydrophobic.
B) A  small part of it becomes hydrophilic.
C) A  small part of it becomes polar.
D) A small part of it becomes negatively charged.
E) A  small part of it becomes positively charged.

Question 70

Mutations in promoter regions of a gene are most likely to _____.

A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) prevent mRNA from being post-transcriptionally modified
E) alter the amino acid sequence

Question 71

Heritable changes in gene expression not due to changes in DNA sequences are known as _____.

A) epigenetics
B) methylation
C) translational mutation
D) differentiation
E) frameshift inheritance

Question 72

Which molecule initiates translation after an egg is fertilized?

A) maternal mRNA
B) paternal promoters in sperm
C) maternal transcription factors
D) transposable elements
E) paternal DNA

Question 73

The master gene that controls eye development in all multicellular eukaryotes is an example of a(n) _____.

A) homeotic gene
B) conserved protein
C) RNA enzyme
D) Barr body
E) translation factor

Question 74

Mutations in an exon region of a gene are most likely to _____.

A) prevent mRNA from being synthesized
B) trap mRNA inside the nucleus
C) prevent mRNA from being recognized by the ribosome
D) prevent mRNA from being post-transcriptionally modified
E) alter the amino acid sequence

Question 75

Mutations at intron-exon splice sites in DNA can lead to a(n) _____.

A) short or truncated protein
B) protein that has a change in polarity
C) change in hydrophobicity
D) unspliced mRNA
E) mRNA that cannot be translated

Question 76

Methylation of histone proteins promotes _____.

A) transcription
B) translation
C) binding of transcription factors
D) condensation of DNA
E) differentiation

Question 77

In mammals, X chromosome inactivation results in _____.

A) a total inactivation of both female X chromosomes
B) only the inactivation of the paternal X chromosome in females
C) only the inactivation of the maternal X chromosome in females
D) the random inactivation of either the paternal or the maternal X in females
E) the inactivation of the maternal X chromosome in males

Question 78

Homeotic genes are, in general, in control of _____.

A) X chromosome inactivation
B) formation of major body parts
C) methylation of nucleotides
D) dosage compensation
E) sex determination

Question 79

The master gene for male sex determination is located on _____.

A) both X chromosomes
B) each autosome
C) the Y chromosome
D) the X chromosome
E) both X and Y chromosomes

Question 80

The tightly condensed nonfunctional X chromosome is called a(n) _____.

A) Barr body
B) Y chromosome
C) autosome
D) X-linked chromosome
E) Watson segment