Deck 6: How Cells Read the Genome: From DNA to Protein

Question 1

What enzyme is depicted in the following schematic drawing?

A) DNA polymerase
B) RNA polymerase
C) Ribosome
D) Reverse transcriptase
E) Topoisomerase

Answer 1

B
Explanation: The enzyme synthesizes RNA using one of the DNA strands as template.

Question 2

DNA and RNA polymerase differ in all of the following EXCEPT...

A) the nucleotide substrates they incorporate.
B) their requirement for a primer.
C) their error rate.
D) the type of chemical reaction they catalyze.
E) their processivity.

Answer 2

D
Explanation: Despite the lack of homology, the reactions catalyzed by these two polymerases are analogous, even though the enzymes work on different substrates. DNA polymerases require a primer and have a much lower error rate compared to RNA polymerases. They are also not as processive on their own.

Question 3

This general transcription factor recognizes the TATA box in RNA polymerase II promoters. It is...

A) the only single-subunit general transcription factor.
B) able to introduce a rather sharp kink in the double helix upon binding to DNA.
C) responsible for the phosphorylation of the RNA polymerase CTD during transcription initiation.
D) also responsible for the recognition of the BRE element in the promoter.
E) All of the above.

Answer 3

B
Explanation: It is the multisubunit TFIID, containing a TATA-binding protein, which, upon binding to the TATA box, creates a sharp kink in the double helix that serves as a landmark to attract other transcription factors.

Question 4

This large and complex general transcription factor has a DNA helicase activity that exposes the template for RNA polymerase II transcription. It also has a kinase activity that phosphorylates the C-terminal domain of the polymerase on Ser5 leading to promoter clearance. It is...

A) TFIIB
B) TFIID
C) TFIIE
D) TFIIF
E) TFIIH

Question 5

Comparing mRNA molecules from human and Escherichia coli cells, which of the following is typically NOT true?

A) A human mRNA has a special 5' cap, while a bacterial mRNA does not.
B) A human mRNA has a poly-A tail, while a bacterial mRNA does not.
C) A human mRNA undergoes alternative splicing, while a bacterial mRNA does not.
D) A human mRNA contains noncoding sequences, while a bacterial mRNA does not.
E) A typical human mRNA encodes one protein, while many bacterial mRNAs encode several different proteins.

Question 6

Which of the following better describes a typical, actively translated mRNA in its journey from the nucleus to the cytosol?

A) Initially in a circular conformation, the mRNA linearizes, enters the cytosol (5' end first), and remains linear.
B) Initially in a circular conformation, the mRNA linearizes, enters the cytosol (3' end first), and remains linear.
C) Initially linear, the mRNA enters the cytosol (5' end first), and adopts a circular conformation.
D) Initially linear, the mRNA enters the cytosol (3' end first), and adopts a circular conformation.
E) Initially linear, the mRNA enters the cytosol (3' end first), and remains linear.

Question 7

Several mechanisms contribute to the diversity of the mRNAs and proteins encoded by a single gene in our genome. Which of the following is normally NOT one of them?

A) Alternative choice of polyadenylation sites
B) Alternative choice of translation initiation sites
C) Alternative choice of transcription initiation sites
D) Alternative choice of the reading frames
E) Alternative choice of splice sites

Question 8

A primary mRNA transcript with three exons is depicted below. Which of the following mature mRNA products of this transcript is a result of exon skipping?

Question 9

How does a eukaryotic cell deal with the superhelical tension in its genomic DNA resulting from the activity of RNA polymerases?

A) DNA gyrase introduces negative supercoils, keeping the DNA under constant tension.
B) The RNA polymerases are allowed to rotate freely around their templates during transcription, leading to the relaxation of the tension.
C) DNA topoisomerases rapidly remove the superhelical tension caused by transcription.
D) The nucleosomes adjust the tension by binding to positively supercoiled regions behind a moving RNA polymerase.
E) All of the above.

Question 10

The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT.
5?…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3?

Question 11

Which of the following types of noncoding RNA chiefly functions in the processing and chemical modification of ribosomal RNAs (rRNAs)?

A) Small nuclear RNAs (snRNAs)
B) Small nucleolar RNAs (snoRNAs)
C) Small interfering RNAs (siRNAs)
D) Transfer RNAs (tRNAs)
E) MicroRNAs (miRNAs)

Question 12

To ensure the fidelity of splicing, the spliceosome...

A) hydrolyzes ATP to undergo complex rearrangements.
B) examines the splicing signals on the pre-mRNA several times.
C) assembles on the pre-mRNA co-transcriptionally.
D) takes advantage of "exon definition."
E) All of the above.

Question 13

After the first and before the second chemical step of RNA splicing, the intron of the pre-mRNA...

A) is still covalently connected to the 3' exon and has an internal branch in the shape of a lariat.
B) is still covalently connected to the 3' exon and is linear.
C) is still covalently connected to the 5' exon and has an internal branch in the shape of a lariat.
D) is still covalently connected to the 5' exon and is linear.
E) is still covalently connected to both of its flanking exons and is linear.

Question 14

The transcript for which of the following noncoding RNA in our cells is expected to undergo 5' cap addition after transcription?

A) 5S rRNA
B) miR-21 (a microRNA)
C) tRNAᴾʰᵉ
D) 5.8S rRNA
E) 18S rRNA

Question 15

Due to their high transcription rate, active ribosomal RNA (rRNA) genes can be easily distinguished in electron micrographs of chromatin spreads. They have a characteristic "Christmas tree" appearance, where the DNA template is the "trunk" of the tree and the nascent RNA transcripts form closely packed "branches." At the base of each branch is an RNA polymerase extending that branch, while RNA processing complexes at the tip of the branch form terminal "ornaments." The top of the tree represents the ... of the rRNA gene, and the "ornaments" are at the ... end of the nascent rRNA molecules.

A) end; 3'
B) end; 5'
C) beginning; either 3' or 5'
D) beginning; 3'
E) beginning; 5'

Question 16

Eukaryotic pre-mRNAs undergo a number of modifications such as capping at the 5' end. A 5' cap...

A) consists of a modified terminal adenine nucleotide.
B) has a 3'-to-5' linkage between the terminal nucleotide and the 5' end of the pre-mRNA.
C) contains a triphosphate bridge between the terminal base and the 5' end of the pre-mRNA.
D) carries a negative charge in the terminal base due to methylation.
E) is identical for all mRNAs that are transcribed by RNA polymerase II.

Question 17

In the following qualitative histogram, which two curves better correspond to human exon and intron length distributions, respectively?

A) Curves 1 and 2
B) Curves 2 and 1
C) Curves 2 and 3
D) Curves 3 and 2
E) Curves 3 and 1

Question 18

Of the following proteins or protein complexes, which one does NOT typically interact with an elongating RNA polymerase II?

A) Histone-modifying enzymes
B) Capping enzymes
C) Chromatin remodeling complexes
D) Mediator complex
E) Histone chaperones

Question 19

For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other.

A) 5'... UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU...3'
B) 5'... UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU...3'
C) 5'... UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA...3'
D) 5'... CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA...3'

Question 20

The enzyme poly-A polymerase is responsible for adding 3' poly-A tails to eukaryotic mRNAs. This enzyme...

A) cuts the mRNA after recognition of the cleavage/polyadenylation signal by CstF and CPSF proteins.
B) polymerizes the tail using an RNA template that is part of the enzyme.
C) is extremely processive.
D) normally adds about 1000 A nucleotides to the mRNA.
E) uses ATP as a substrate.

Question 21

Which of the following is true about the molecule shown in the following drawing?

A) Its gene is transcribed by RNA polymerase I.
B) There are about 50 genes in our genome encoding this type of molecule.
C) This molecule normally undergoes various covalent modifications.
D) It is normally composed of about 20 monomers.
E) Its gene transcript normally undergoes alternative splicing.

Question 22

Activation of an amino acid by an aminoacyl-tRNA synthetase involves the covalent linkage of...

A) AMP to the amino acid.
B) ADP to the amino acid.
C) AMP to the tRNA.
D) ADP to the tRNA.
E) ADP to the enzyme.

Question 23

How is tRNA splicing different from mRNA splicing in eukaryotic cells?

A) tRNA splicing does not proceed via transesterification reactions.
B) tRNA splicing is carried out by proteins only.
C) tRNA splicing does not create a lariat intermediate.
D) tRNA splicing involves RNA endonuclease and RNA ligase activities.
E) All of the above.

Question 24

The following mRNA sequence is taken from the middle of exon 3 in a mature mRNA that has 12 exons. Knowing that this mRNA does not undergo nonsense-mediated decay, which of the reading frames shown is the correct one for this mRNA? Write down 1, 2, or 3 as your answer.

Question 25

In a gene that normally contains three exons, which of the following changes probably will NOT activate the nonsense-mediated mRNA decay pathway? The sizes of exons 1 to 3 are 100, 150, and 200 nucleotide pairs, respectively.

A) A nonsense mutation in exon 1.
B) A nonsense mutation in exon 2.
C) A mutation in the first intron resulting in the inclusion of a large intronic fragment in the mature mRNA.
D) A frameshift mutation in exon 1.
E) A mutation in exon 2 leading to its loss through exon skipping.

Question 26

An elongating ribosome is bound to appropriate tRNAs in both the A and the P sites and is ready for peptidyl transfer. What happens next?

A) The carboxyl end of the polypeptide chain is released from the P-site tRNA and joined to the free amino group of the amino acid linked to the A-site tRNA.
B) The amino end of the polypeptide chain is released from the P-site tRNA and joined to the free carboxyl group of the amino acid linked to the A-site tRNA.
C) The carboxyl end of the amino acid is released from the A-site tRNA and joined to the free amino group of the polypeptide chain linked to the P-site tRNA.
D) The amino end of the amino acid is released from the A-site tRNA and joined to the free carboxyl group of the polypeptide chain linked to the P-site tRNA.

Question 27

The nucleolus is a dynamic subcompartment within the nucleus and its size varies depending on the circumstances. In which of the following cells would you NOT expect to see the nucleoli?

A) A yeast cell undergoing DNA replication
B) A human neuron in a quiescent (G₀) state
C) A human macrophage active in phagocytosis
D) A fruit fly embryonic nucleus in the G₂ phase of the cell cycle
E) A mouse embryonic cell in the metaphase stage of mitosis

Question 28

Which of the following nucleotides is hydrolyzed in both transcription and in translation elongation?

A) ATP
B) GTP
C) TTP
D) UTP
E) CTP

Question 29

Which of the following features is common between the bacterial and eukaryotic ribosomes in translation initiation?

A) They both use an initiator tRNA that carries formylmethionine.
B) They both bind to the 5' end of the mRNA and move forward to find the start codon.
C) They both recognize the start codon by interacting with the Shine-Dalgarno sequence.
D) They both interact with various translation initiation factors.
E) All of the above.

Question 30

Polysomes...

A) are large cytoplasmic assemblies made of several ribosomes each translating their exclusive mRNA.
B) are only found in the eukaryotic cytoplasm.
C) can take advantage of the circularization of eukaryotic mRNA (by interactions between the 5' and 3' ends of the mRNA) to further speed up the rate of protein synthesis.
D) are mostly translationally inactive and are normally used by the cell to store the ribosomes and their associated mRNAs for future use.
E) All of the above.

Question 31

The modified nucleotide shown below is normally found in mature...

A) tRNAs.
B) ribosomes.
C) spliceosomes.
D) snoRNAs.
E) All of the above.

Question 32

Cajal bodies in the eukaryotic cell nucleus...

A) are stockpiles of fully mature snRNPs and other RNA processing components.
B) can only be observed by electron microscopy.
C) are absolutely required in all cell types.
D) speed up the maturation and assembly of snRNPs and snoRNPs.
E) are the main sites of pre-mRNA splicing.

Question 33

How fast does a bacterial ribosome move on an mRNA?

A) At about 2 nucleotides per second, significantly lower than the speed of the RNA polymerase.
B) At about 5 nucleotides per second, comparable to the speed of the RNA polymerase.
C) At about 10 nucleotides per second, significantly lower than the speed of the RNA polymerase.
D) At about 20 nucleotides per second, comparable to the speed of the RNA polymerase.
E) At about 60 nucleotides per second, comparable to the speed of the RNA polymerase.

Question 34

As an mRNA molecule is processed in the nucleus, it loses some proteins and binds to new ones, some of which are used in mRNA surveillance pathways. The presence of which of the following molecules on an mRNA is a signal that the mRNA is still NOT ready for nuclear export?

A) Cap-binding complex
B) Exon junction complex
C) snRNPs used in splicing
D) poly-A-binding proteins
E) SR proteins

Question 35

Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?

A) Ribosome assembly
B) rRNA gene transcription
C) Telomerase assembly
D) tRNA processing
E) All of the above

Question 36

This complex uses ATP and forms an "isolation chamber" for its misfolded protein substrates, allowing them to fold to their native conformation. It is called...

A) a proteasome.
B) a ribosome.
C) Mediator.
D) a chaperonin.
E) an exosome.

Question 37

The structural formulas for a few antibiotics that target the ribosome are shown below. Which one do you think is that of puromycin? Hint: puromycin mimics the structure of an amino acid linked to a tRNA molecule.

Question 38

On the ribosome, the mRNA is read from ..., and the polypeptide chain is synthesized from...

A) 5' to 3'; C- to N-terminus.
B) 5' to 3'; N- to C-terminus.
C) 3' to 5'; C- to N-terminus.
D) 3' to 5'; N- to C-terminus.

Question 39

Each aminoacyl-tRNA synthetase activates a certain amino acid by attaching it to its corresponding tRNA(s) through a high-energy linkage...

A) between the amino group of the amino acid and the 3' hydroxyl group of the tRNA.
B) between the amino group of the amino acid and the 5' hydroxyl group of the tRNA.
C) between the carboxyl group of the amino acid and the 3' or 2' hydroxyl group of the tRNA.
D) between the carboxyl group of the amino acid and the 5' hydroxyl group of the tRNA.
E) between the amino group of the amino acid and the 3' or 2' hydroxyl group of the tRNA.

Question 40

The specific transfer RNA used for the incorporation of selenocysteine in proteins recognizes the UGA codon, which is normally a translation stop codon. What prevents this tRNA from reading through all the other "legitimate" UGA stop codons in the cells and causing a massive, disastrous recoding?

A) The cells that have selenocysteine in their proteins do not normally use the UGA stop codon and always use the other two stop codons (UAA and UAG) instead.
B) This tRNA is made in such a small amount that its side effects are negligible.
C) This tRNA only interacts with the UGA codon in the P site of the ribosome, and therefore does not interfere with the normal function of the codon in translation termination, which takes place in the A site.
D) The mRNAs encoding the selenocysteine-containing proteins also contain additional sequences required for the recoding event.

Question 41

How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a protein that has been tagged for degradation with a polyubiquitin chain?

A) None; the digestion does not require ATP hydrolysis and is exergonic
B) One
C) Two
D) Ten
E) Many; the number depends on the specific protein

Question 42

The anticodon sequence of a phenylalanine-specific tRNA is 5'-GAA-3'. Given the wobble base-pairing rules presented in the following table, how many different codons can be "read" by this tRNA? Write down your answer in digits, e.g. 12.

Question 43

In the following diagram showing the overall flow of genetic information in all living cells, what is the name of the process indicated with a question mark?

Question 44

In the following representation of a single-stranded RNA molecule, the nucleotide residues are drawn as gray circles, while base-pairing interactions between them are indicated by dashed lines. The structure of this RNA molecule has...

A) one hairpin loop and one pseudoknot.
B) one pseudoknot only.
C) three hairpin loops and a four-stem junction.
D) two hairpin loops and a three-nucleotide bulge.
E) three hairpin loops.

Question 45

Sort the following events in the order that they occur during transcription initiation in Escherichia coli. Your answer would be a four-letter string composed of letters A to D only; e.g. DCAB.
(A) Abortive initiation trials
(B) ? Factor release from the RNA polymerase holoenzyme
(C) Binding of the holoenzyme to the promoter in the "closed" complex
(D) Formation of the transcription bubble

Question 46

Indicate true (T) and false (F) statements below regarding mRNA splicing in human cells. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( ) Introns must be removed in the order in which they occur along the pre-mRNA.
( ) Nucleosomes tend to be positioned over exons (on average, about one nucleosome per exon).
( ) Exon size tends to be much more variable than intron size.
( ) The exon junction complexes mark the sites on the mRNA where splicing has not been successful.

Question 47

Fill in the blank. These RNA molecules can catalyze a wide variety of biochemical reactions, including peptide bond formation and RNA splicing. They can be found in nature or selected in vitro for a desired function. Such a molecule is called a(n) ...

Question 48

In the following schematic drawing, a transcribing RNA polymerase is moving toward the right on the DNA template as indicated. If the polymerase is allowed to rotate freely while the DNA is kept from doing so, would the enzyme rotate in a right-handed (R) or left-handed (L) fashion around the template? Write down R or L as your answer.

Question 49

Three consecutive nucleotides in RNA (such as AUC or GUA) constitute a triplet called a ..., which can specify an amino acid or a stop signal for translation.

Question 50

You have identified an RNA-binding protein that can bind directly (with varying affinities) to mRNA molecules that bear the following sequences near the 3' splice sites of their exons. Based on these results, what is the five-nucleotide consensus sequence for the binding site of this protein? Your answer would be a five-letter string composed of letters A, U, C, or G only; e.g. UUUAG.

Question 51

What is the function of the 19S cap in the proteasome complex?

A) Recognizing the proteins that will be degraded
B) Unfolding the proteins that will be degraded and threading them into the central 20S cylinder for digestion
C) Removing the polyubiquitin chain from the proteins that will be degraded
D) Hydrolyzing ATP to make the digestion process highly efficient
E) All of the above

Question 52

Your friend who is studying the sequence conservation around the branch-point site on a subset of pre-mRNAs in Macaca mulatto (rhesus macaque) has sent you the following sequence logo of the region of interest, but has forgotten to indicate the position of the branch-point nucleotide itself within this region. Where do you think it is? Write down the position number (1 to 8) as your answer.

Question 53

Indicate true (T) and false (F) statements below regarding the accuracy of translation by the ribosome. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( ) The difference in the binding affinity of a codon to a correct versus incorrect anticodon CANNOT by itself account for the high accuracy of translation.
( ) GTP hydrolysis by EF-Tu both speeds up translation and increases its accuracy.
( ) The ribosome can detect correct Watson-Crick base-pairing between the codon and anticodon in the A site, and consequently trigger GTP hydrolysis by EF-Tu.
( ) Even after GTP hydrolysis by EF-Tu, the ribosome can prevent wrong amino acid incorporation by kinetic proofreading.

Question 54

Indicate true (T) and false (F) statements below regarding the folding of proteins upon their synthesis. Your answer would be a five-letter string composed of letters T and F only, e.g. TFFFF.
( ) A globular protein can fold to its native form while still within the ribosome.
( ) A protein can begin to fold and to bind to other proteins while still being synthesized on the ribosome.
( ) A protein may undergo several cycles of hsp70 binding and release while still being synthesized on the ribosome.
( ) A molten globule can form only after the synthesis of the protein is complete.
( ) A protein typically undergoes hsp60-assisted folding while still being synthesized.

Question 55

Indicate true (T) and false (F) statements below regarding the RNA world hypothesis. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( ) According to this hypothesis, RNA in primitive cells was responsible for storing genetic information, while proteins were responsible for the catalysis of chemical reactions.
( ) The existence of natural ribozymes supports this hypothesis.
( ) In support of this hypothesis, all peptides in present-day cells are made by the ribosome.
( ) All present-day cells use DNA as their hereditary material.

Question 56

Indicate whether each of the following is located (or takes place) in the large (L) or the small (S) ribosomal subunit. Your answer would be a four-letter string composed of letters L and S only, e.g. LLLS.
( ) Peptide bond formation
( ) Codon-anticodon interaction
( ) The path of the mRNA
( ) The polypeptide exit tunnel

Question 57

In humans, nearly 80% of proteins are acetylated on their N-terminal residue, a modification known to be recognized by a specific E3 enzyme, which directs the ubiquitylation of the protein for rapid degradation. Does this mean that all of these proteins are actively degraded at any given time?

A) Yes; this high turnover rate ensures that their activity is under tight control.
B) Yes; but they are not fully degraded in this way and can still function as protein fragments.
C) No; the destruction signal can be buried in the interior of the protein or bound to other proteins.
D) No; the E3 enzyme recognizing this mark is inactive most of the time.

Question 58

No matter where translation begins, only one polypeptide sequence pattern can be obtained from the translation of an mRNA chain with the sequence (AC)n; that is, an mRNA with the sequence 5'...ACACACACAC...3'. In contrast, an mRNA chain with the sequence (ACG)n can be translated to polypeptide sequences of three distinct patterns, depending on the choice of the reading frame. Using similar judgment, how many different polypeptide sequence patterns can be obtained from an mRNA chain with the sequence (ACGU)n? Write down your answer in digits, e.g. 12.