Deck 16: Dna Technology

Question 1

When the FBI investigates crimes with DNA evidence, they compare 13 different noncoding regions of the human genome between the DNA evidence and the suspect. Why is it important to look at so many regions?

A)Repeating the test in different areas of the DNA ensures that the investigator did not make any mistakes in determining the DNA sequence.
B)Most regions of the human genome are identical, so you have to look in many locations to make sure you find a region that shows differences.
C)The more regions of the DNA you examine, the less likely you are to run into a coincidental similarity between DNA sequences.
D)Restriction enzymes only work in these 13 regions of the human genome.

Answer 1

C

Question 2

Which of the following is the biggest challenge currently faced by scientists researching gene therapy?

A)identifying the location of genes that cause genetic disorders within the human genome
B)finding a way to direct recombinant viruses to specific cells and/or locations in the genome
C)determining the DNA sequence of the genes that cause genetic disorders
D)finding a way to get recombinant DNA into human cells

Answer 2

B

Question 3

A vector is used to

A)transfer a gene to a specific cell in the body.
B)separate DNA fragments from one another.
C)probe DNA for faulty genes.
D)attach DNA fragments to one another.

Answer 3

A

Question 4

The nuclear DNA of the embryo that results from the process shown in the diagram below

A)is identical to the nuclear DNA of the Scottish Blackface sheep.
B)is identical to the nuclear DNA of the Finn Dorset sheep.
C)is a unique mix of the nuclear DNA from both of the pictured sheep.
D)contains one full set of chromosomes from each of the pictured sheep.

Question 5

In comparison to DNA technology, selective breeding is

A)less precise and slower.
B)faster and more direct.
C)slower and more accurate.
D)faster and safer.

Question 6

Which of the following is not an example of humans changing the DNA of an organism?

A)treating a patient with a medication that cures an infection
B)adding a disease-resistant gene to a crop plant
C)modifying bacteria to produce human insulin
D)gene therapy

Question 7

You are shown the following result of gel electrophoresis. Column 1 represents blood found on the arm of a crime victim, but it is not the victim's blood. The other columns are blood taken from various suspects. Which suspect's blood was found on the victim's arm?

A)2
B)3
C)4
D)5

Question 8

The use of DNA analysis to identify individuals is known as

A)PCR testing.
B)DNA fingerprinting.
C)genetic modification.
D)cloning.

Question 9

A restriction enzyme from a bacterium is able to cut a human's DNA because

A)bacteria and humans are both prokaryotes.
B)all organisms use the same DNA bases.
C)bacteria and humans have identical genomes.
D)a given restriction enzyme can cut DNA at several different sequences.

Question 10

Researchers commonly use DNA technology to create recombinant DNA that has a "glowing" protein product. Which of the following is a benefit of this technology?

A)This technology provides proof to nonscientists that genetic engineering is safe.
B)Organisms that express this gene can obtain energy through photosynthesis rather than consumption.
C)The genes for glowing proteins are easier to clone than other genes.
D)Glowing proteins allow scientists to see where a particular gene is expressed in living cells.

Question 11

Which of the following is not required for reproductive cloning?

A)an egg cell that lacks a nucleus
B)a somatic cell
C)an electrical current
D)a restriction enzyme

Question 12

Deliberately transferring a gene from one species to another is an example of

A)constructing a gene library.
B)genetic engineering.
C)the polymerase chain reaction.
D)cloning.

Question 13

The immune disorder adenosine deaminase (ADA)deficiency is the result of a mutation in one gene. How could gene therapy be used to treat this disorder?

A)Red blood cells could be induced to produce the protein encoded by the mutated ADA gene.
B)Cells containing a corrected ADA gene could be injected into patients with ADA.
C)The patients could swallow synthetic blood cells.
D)Patients could be injected with a hybrid molecule made of the DNA and RNA of the normal ADA gene.

Question 14

DNA identification of individuals is possible because due to differences in DNA sequence,

A)the same restriction enzyme cuts different individuals' DNA in different places.
B)a different restriction enzyme is needed to cut each person's DNA.
C)a different species of bacteria is needed to create a DNA probe for each person.
D)DNA probes hybridize with different genes in different people.

Question 15

In DNA fingerprinting, which regions of DNA would provide the strongest evidence of a genetic relationship?

A)regions with noncoding and spacer DNA
B)regions that contain the genes for hemoglobin
C)regions that might contain genes related to personality disorders
D)regions that can be easily fragmented

Question 16

This graph shows that genetically modified salmon _____ than unmodified salmon.

A)breed more quickly
B)are, at maturity, larger
C)grow faster
D)do more harm to native insect populations

Question 17

To make recombinant DNA,

A)two nonhomologous chromosomes are induced to undergo crossing-over during meiosis.
B)the entire genome of one organism is fused to a plasmid.
C)pieces of DNA from different organisms are cut with restriction enzymes and then glued together with ligase.
D)DNA polymerase is used to make multiple copies of the DNA sequences of two organisms at the same time.

Question 18

DNA technology can be used with all organisms because they all

A)contain plasmids.
B)can contract the same diseases.
C)share the same chemical DNA structure.
D)contain the same genes.

Question 19

DNA extraction

A)uses restriction enzymes to prevent chromosomes from unraveling.
B)can only occur when the gene of interest has been amplified by PCR.
C)occurs only in prokaryotic cells because they lack a protective nucleus.
D)requires that all non-DNA organic compounds be removed with chemicals.

Question 20

Human gene therapy involves

A)correcting genetic disorders by modifying the genes that cause them.
B)using plasmids to carry genes that will break down a specific harmful gene in a patient.
C)inserting genes from other organisms into the human genome.
D)using PCR to produce large amounts of normal DNA that can be injected into a patient.

Question 21

After gel electrophoresis of a DNA sample has been performed, the different bands found in one lane of a gel are

A)different-sized DNA molecules.
B)the digested restriction enzyme.
C)RNA from different cells.
D)DNA hybridization sites.

Question 22

In research, restriction enzymes are used to

A)stop replication of DNA at a specific base during DNA sequencing.
B)cut DNA molecules into pieces that can be used to create recombinant DNA.
C)measure the relative amounts of each base in a DNA molecule.
D)join two fragments of DNA together to form a molecule of recombinant DNA.

Question 23

Which of the following is not involved in creating recombinant DNA?

A)restriction enzymes
B)ligase
C)RNA
D)plasmids

Question 24

Among these DNA fragments, which would move most quickly during gel electrophoresis?

A)AATAAT
B)AATAATAATAAT
C)AAATTAAT
D)AATAATAATAATAATAATAAT

Question 25

In nature, the function of a restriction enzyme is to

A)connect DNA fragments after replication.
B)protect bacteria from invading foreign DNA.
C)speed up the rate at which bacteria can metabolize their energy sources.
D)make numerous copies of a given gene.

Question 26

Cloning and sequencing are important in the study of inherited diseases, because

A)many copies of the gene can be ligated.
B)the protein product that produces the disease can be determined.
C)the process can be reversed to cure the disease.
D)the clones can be easily paired.

Question 27

Ligases are used to

A)connect two DNA fragments to each other.
B)snip DNA into smaller molecules.
C)separate DNA molecules by size.
D)determine the exact base sequence of a DNA molecule.

Question 28

If you knew the sequence of a gene in one organism, how could you determine if another organism had a similar gene?

A)treat the genomes of both organisms with the same restriction enzyme and compare the patterns of the bands produced with gel electrophoresis
B)insert the known gene into a vector and use the vector to insert the known gene into the other organism
C)create labeled DNA probes from the known gene and use them to search the genome of the other organism
D)create a hybrid of the two organisms by breeding them and check for mutations

Question 29

Gel electrophoresis is used to

A)connect two DNA fragments to each other.
B)snip DNA into smaller molecules.
C)separate DNA molecules by size.
D)determine the exact base sequence of a DNA molecule.

Question 30

As a result of the human genome project, we know

A)the DNA sequence of every human chromosome.
B)the location of every disease-causing mutation in the human DNA sequence.
C)the DNA sequences of all organisms relevant to human existence.
D)how to cure or prevent all genetically inherited disorders.

Question 31

The genes for the normal mutant alleles of a gene are cut with the same restriction enzyme. The resulting DNA fragments were separated by gel electrophoresis, producing the gel shown in the figure below. Why are the patterns produced by these two alleles different?

A)The normal hemoglobin gene is cut by two restriction enzymes, but the sickle cell anemia allele is cut by only one restriction enzyme.
B)The gene for the normal allele is much larger than the gene for sickle cell anemia.
C)The gene for the normal allele has a sequence recognized by DdeI, but the gene for sickle cell anemia does not.
D)The sickle cell allele has the ability to produce ligase to repair the damage done by restriction enzymes, but the normal allele does not.

Question 32

Gel electrophoresis uses

A)an electrical current.
B)ligases.
C)DNA polymerase.
D)viral vectors.

Question 33

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

A)One; SmaI does not cut this piece of DNA.
B)Two; SmaI cuts this piece of DNA once.
C)Two; SmaI cuts this piece of DNA twice.
D)Four; SmaI cuts this piece of DNA four times.

Question 34

The figure below shows the first cycle in polymerase chain reaction (PCR).
What is the role of the structure marked "P" in this figure?

A)The "P" represents the heat-tolerant DNA polymerase used in PCR to copy the gene of interest.
B)The "P" represents a sequence of DNA complementary to parts of the gene being amplified that allows DNA polymerase to attach to the gene.
C)The "P" indicates where on the DNA that DNA polymerase should terminate replication.
D)The "P" indicates the location of the promoter for the gene being amplified.

Question 35

During gel electrophoresis, DNA moves from the

A)edges of the gel to the middle of the gel.
B)middle of the gel to the edges.
C)negative end of an electrical field to the positive end of the electrical field.
D)positive end of an electrical field to the negative end of the electrical field.

Question 36

To screen the genome of a bacterium for a particular gene you would use _____that attach to complementary DNA sequences.

A)gels
B)ligases
C)DNA probes
D)restriction enzymes

Question 37

Which of the following DNA fragments would bind to the short probe, AAG?

A)ATACCAGGC
B)AAATGTATG
C)AAATTCATG
D)TTAGGTTTG

Question 38

A sample of the same DNA is placed into each of two test tubes. Each tube is treated with a restriction enzyme and the resulting fragments are separated by gel electrophoresis producing the gel shown in the figure below. Which of the following explains why the pattern of DNA fragments differs in these two samples?

A)Different restriction enzymes must have been used in the different tubes.
B)One tube was heated, but the other tube was not.
C)Ligase was added to one of the tubes, but not the other.
D)The restriction enzyme added to the tubes cut DNA at more than one sequence.

Question 39

The most efficient method of determining the DNA sequence of a gene is to

A)insert the ligase gene.
B)expose it to radioactivity.
C)use an automated sequencing machine.
D)hand count the base pairs.

Question 40

A restriction enzyme cuts DNA into fragments

A)whenever the correct ligase is present.
B)only in laboratory conditions.
C)only in the organism that produces it.
D)when mixed with the DNA that contains the target DNA sequence.

Question 41

To clone a recombinant plasmid you would

A)insert the plasmid into a virus and inject the virus into a human cell.
B)allow bacteria to take up the plasmid and copy it many, many times.
C)Mix the plasmid with restriction enzymes and nucleotides.
D)Use ligase to fuse the ends of the plasmids together.

Question 42

In RNA ____________________, the expression of a specific gene is blocked by small pieces of RNA.

Question 43

Interference RNA (RNAᵢ)functions by

A)slowing or preventing the formation of ribosomes in cells infected with a virus.
B)preventing the replication of viral DNA.
C)producing restriction enzymes that degrade viral DNA.
D)"silencing" viral genes by binding to complementary sequences.

Question 44

DNA moves toward the ____________________ charged end of an electrical field during gel electrophoresis.

Question 45

The polymerase chain reaction (PCR)technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes?

A)Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary.
B)Bacterial enzymes can move through the gel only during PCR electrophoresis.
C)DNA can be cut into fragments only at high temperatures.
D)The temperature required to separate DNA strands during PCR degrades most normal enzymes.

Question 46

The goal of DNA ____________________ is to make many copies of a piece of recombinant DNA so that the DNA can be further manipulated and studied.

Question 47

Human gene ____________________ seeks to correct genetic disorders by fixing the genes that cause the disorders.

Question 48

Hind III and AluI are examples of ____________________ used to cut DNA at specific sites.

Question 49

A detective finds a miniscule spot of blood on a murder suspect's shirt. What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

A)inserting the blood's DNA into viral DNA
B)polymerase chain reaction (PCR)
C)inserting the sample's DNA into a plasmid
D)using ligases to bond the DNA fragments together for sequencing

Question 50

During ____________________ cloning, the nucleus of an egg cell is replaced with the nucleus of a somatic cell from the individual being cloned.

Question 51

____________________ catalyzes the formation of covalent bonds between two DNA fragments, creating a single piece of DNA.

Question 52

Cloning is useful because it

A)repairs broken DNA.
B)mixes the DNA from two different organisms.
C)produces many copies of recombinant DNA.
D)determines the base sequence of a gene.

Question 53

The DNA primers used in PCR are

A)identical to the entire base sequence of one strand of the DNA.
B)produced when a gene of interest is read by restriction enzymes.
C)attached to the gene of interest by ligase.
D)complementary to DNA sequences at both ends of the DNA sequence of interest.

Question 54

A segment of DNA in a test tube replicates and produces many copies of itself. What was probably in the test tube that enhanced this process?

A)a ligase
B)a restriction enzyme
C)DNA polymerase
D)an electric current

Question 55

Because the ____________________ regions of DNA show the highest level of variation between individuals, they are most commonly analyzed during DNA fingerprinting.

Question 56

The polymerase chain reaction (PCR)is used to

A)produce many copies of a selected DNA sequence.
B)insert DNA from one organism into a new host.
C)screen for a particular gene.
D)deliver DNA products into a human patient.

Question 57

Which of the following is the best way to make many copies of a vector containing recombinant DNA?

A)polymerase chain reaction
B)DNA hybridization
C)reproductive cloning
D)DNA cloning

Question 58

DNA polymerase is used in the laboratory to

A)perform gel electrophoresis procedures.
B)cure patients of certain genetic diseases.
C)make many copies of a DNA sequence.
D)attach DNA fragments to each other.

Question 59

Genetic engineering is a process in which specific sequences of ____________________ are deliberately isolated, modified, and inserted back into a host organism.

Question 60

A(n)____________________ is a small, circular portion of DNA that is found in bacteria and is not part of the main genome.

Question 61

The use of genetic engineering has social, economic, and ecological implications.

Question 62

The bacterium shown in the image below is a genetically modified organism.

Question 63

Examine the image below of a gel produced by the electrophoresis of DNA. The smallest fragment on the gel is the one indicated by the star.

Question 64

If you wanted to know what proteins were produced in a bacterium in response to the presence of a particular chemical, you would look to scientists in the field of ____________________.

Question 65

Genetic engineering works only on animals and has not yet been successfully used on plants.

Question 66

A DNA ____________________ that binds to a certain DNA sequence can be used to test for the presence of an allele or gene in a genome.

Question 67

Restriction enzymes work only on bacterial DNA.

Question 68

Genetic engineering has been used to mass produce insulin for diabetics.

Question 69

DNA ____________________ occurs when complementary single-stranded DNA molecules from two different sources undergo base pairing.

Question 70

There are no risks associated with DNA technology.

Question 71

RNAᵢ is not a useful tool for the development of cures for genetically inherited diseases.

Question 72

Genetically modified plants can pass their recombinant DNA to wild plants of the same species through their pollen.

Question 73

Only 5 percent of processed foods found in U.S. grocery stores contain ingredients from genetically engineered plants.

Question 74

Viruses can be used to deliver "good" copies of genes to patients with certain genetic disorders.

Question 75

DNA from one organism will not bond to DNA from another organism.

Question 76

It is theoretically impossible for two individuals (other than identical twins)to have the same DNA fingerprint.

Question 77

The presence of double-stranded RNA stimulates the ____________________ system of the human body, making it hard to determine if RNAᵢ is actually silencing the targeted gene.

Question 78

In the first step of the polymerase chain reaction (PCR), the two strands of the DNA being amplified must be separated by exposing the DNA to high ____________________.

Question 79

DNA fingerprinting can prove guilt without fail.

Question 80

The result of cloning is a piece of DNA that contains fragments from at least two different organisms.