Deck 10: How Genes Work

Full screen (f)
exit full mode
Question
The key enzyme used during transcription is

A) RNA polymerase.
B) DNA polymerase.
C) rRNA.
D) terminase.
Use Space or
up arrow
down arrow
to flip the card.
Question
Which of the following is true of transcription?

A) It destroys the DNA template.
B) The DNA molecule must unwind.
C) Base pairing is unimportant.
D) The end result is a protein.
Question
Which of the following does NOT take place in the nucleus?

A) transcription
B) intron removal
C) DNA replication
D) translation
Question
As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

A) promoter.
B) intron.
C) start codon.
D) anticodon.
Question
DNA technology can be used with all organisms because they all

A) contain antibodies.
B) can contract the same diseases.
C) share the same chemical DNA structure.
D) contain the same genes.
Question
Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei.Therefore,prokaryotic

A) cells are unable to undergo transcription and translation.
B) cells do not need to undergo translation.
C) cells do not need to undergo transcription.
D) transcription and translation both take place in the cytoplasm.
Question
The bases present in an RNA molecule are

A) C, T, A, and G.
B) U, A, C, and G.
C) G, C, U, and T.
D) U, C, T, and A.
Question
Protein-coding genes specify the production of ________ as their immediate product.

A) rRNA
B) tRNA
C) DNA
D) mRNA
Question
During transcription,

A) the DNA strands replicate, producing four mRNA molecules.
B) each strand in the DNA molecule directs the production of an mRNA molecule.
C) a template strand of DNA directs the production of an mRNA molecule.
D) a template strand of DNA directs the production of a tRNA molecule.
Question
Bacteria and humans use the same DNA components,and both kinds of cells also perform transcription and translation.Which of the following choices is a potentially significant outcome of this shared mechanism?

A) Bacteria are able to transcribe and translate human DNA, and thus they potentially could produce human proteins.
B) Bacteria are able to transcribe and translate human DNA; thus, they could evolve into humans.
C) Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same.
D) Bacterial and human DNA are identical in sequence because the method for producing them is the same.
Question
A mutation occurs in the promoter of a protein-encoding gene.How might this mutation affect the production of the protein encoded by the gene?

A) The mRNA made from this gene would exhibit the same mutation and, therefore, would not fold or function properly.
B) The protein made from the promoter would have a different amino acid sequence and, therefore, would not function properly.
C) The promoter might not be recognized by RNA polymerase, so the enzyme would be unable to attach to the promoter and start transcription.
D) The start codon would be missing from the mRNA made from this gene, so the mRNA could not be translated.
Question
Some viruses produce an enzyme called reverse transcriptase which causes the reverse process of transcription.Based on your understanding of gene expression,this enzyme should produce ________ from a(n)________ template.

A) RNA; DNA
B) DNA; RNA
C) proteins; RNA
D) RNA; protein
Question
In bacteria,the antibiotic chloramphenicol prevents amino acids from bonding.The MOST likely reason that bacteria die from treatment with chloramphenicol is because the antibiotic

A) inhibits transcription.
B) inhibits translation.
C) causes the wrong bases to be added to the growing mRNA strand.
D) causes the wrong amino acids to be bound to the tRNA strands.
Question
The information in a gene is encoded by the

A) introns of eukaryotic cells.
B) amino acids that make up the genes.
C) base sequences of the gene's DNA.
D) rRNA that transfers amino acids to ribosomes.
Question
If a strand of DNA has the sequence CGTAA,the RNA made from this molecule will have the sequence

A) CGTAA.
B) GCUTT.
C) TAGCC.
D) GCAUU.
Question
The function of genes is to control the production of

A) enzymes.
B) structural proteins.
C) all proteins.
D) amino acids.
Question
In bacteria,the antibiotic erythromycin prevents ribosomes from functioning.The MOST likely reason that bacteria die from treatment with erythromycin is because the antibiotic

A) inhibits transcription.
B) inhibits translation.
C) causes the wrong bases to be added to the growing mRNA strand.
D) causes the wrong amino acids to be bound to the tRNA strands.
Question
The order of the bases in DNA determines the order of the

A) amino acids in DNA.
B) bases in a protein.
C) amino acids in mRNA.
D) bases in mRNA.
Question
Following transcription,the

A) strands of DNA bond back to each other.
B) mRNA is digested.
C) DNA molecule is broken down.
D) ribosome is released from the tRNA molecule.
Question
A human gene put into a plant cell will

A) not produce a protein.
B) produce a plant protein.
C) produce the same protein produced in a human cell.
D) produce a hybrid protein consisting of both human and plant components.
Question
Which of the following codons codes for proline? <strong>Which of the following codons codes for proline?  </strong> A) UCC B) CCU C) UUU D) CUU <div style=padding-top: 35px>

A) UCC
B) CCU
C) UUU
D) CUU
Question
Which of the lettered arrows in the diagram below of translation indicates a codon? <strong>Which of the lettered arrows in the diagram below of translation indicates a codon?  </strong> A) A B) B C) C D) D <div style=padding-top: 35px>

A) A
B) B
C) C
D) D
Question
Which of the following is a codon?

A) U
B) UU
C) UUU
D) UUUU
Question
Which molecules are involved in translation?

A) DNA and RNA
B) mDNA, tDNA, and rDNA
C) mRNA, tRNA, and rRNA
D) proteins, amino acids, and DNA
Question
Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA? <strong>Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA?  </strong> A) tyrosine-tyrosine-alanine B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine C) methionine-proline-glutamate D) methionine-proline-glutamate-isoleucine-alanine <div style=padding-top: 35px>

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Question
Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG. <strong>Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG.  </strong> A) ACAUGCUAUAUCCCG B) ACATGCTATATCCCG C) cysteine-threonine-isoleucine-glycine D) threonine-cysteine-tyrosine-isoleucine-proline <div style=padding-top: 35px>

A) ACAUGCUAUAUCCCG
B) ACATGCTATATCCCG
C) cysteine-threonine-isoleucine-glycine
D) threonine-cysteine-tyrosine-isoleucine-proline
Question
Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation.In this analogy,what would best match the job of the ribosome?

A) the instructions
B) the person building the bookshelf
C) the pieces of wood
D) the bookshelf
Question
A smartphone app converts spoken English into Spanish.This is similar to the process by which ________ are converted into ________.

A) nitrogenous bases in DNA; nitrogenous bases in mRNA
B) nitrogenous bases in mRNA; a sequence of amino acids
C) amino acids in a protein; nitrogenous bases in tRNA
D) nitrogenous bases in tRNA; nitrogenous bases in mRNA
Question
Which of the following is true of rRNA?

A) It is made up of base pairs.
B) It carries amino acids.
C) It is not translated.
D) It helps transcribe DNA.
Question
Which of the following codons codes for the same amino acid as the codon AGU? <strong>Which of the following codons codes for the same amino acid as the codon AGU?  </strong> A) AGA B) CGU C) UCA D) GCU <div style=padding-top: 35px>

A) AGA
B) CGU
C) UCA
D) GCU
Question
What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation? <strong>What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation?  </strong> A) UCG B) AGC C) TCC D) Serine <div style=padding-top: 35px>

A) UCG
B) AGC
C) TCC
D) Serine
Question
An mRNA molecule that is 99 bases long will create a protein composed of

A) 33 amino acids.
B) 99 amino acids.
C) 33 tRNA molecules.
D) 99 tRNA molecules.
Question
Which RNA molecule brings new amino acids to the growing protein chain in translation?

A) mRNA
B) tRNA
C) rRNA
D) dRNA
Question
The codon GAU codes for which amino acid? <strong>The codon GAU codes for which amino acid?  </strong> A) CUA B) CTA C) aspartate D) leucine <div style=padding-top: 35px>

A) CUA
B) CTA
C) aspartate
D) leucine
Question
The importance of tRNA is that it

A) carries a specific amino acid to the mRNA.
B) reads the DNA molecule.
C) contains codons that specify amino acids.
D) is important in the construction of ribosomes.
Question
During translation,

A) many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein.
B) one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein.
C) strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein.
D) one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.
Question
In bacteria,the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome.The MOST likely reason that bacteria die from treatment with tetracycline is because the antibiotic

A) inhibits the cell from producing the mRNA.
B) causes the tRNA molecules to randomly arrange into proteins that do not function.
C) causes tRNA rather than mRNA to be made into proteins.
D) prevents the bacteria from assembling essential proteins.
Question
Each set of three bases in an mRNA molecule codes for one of 20 specific

A) rRNA molecules.
B) nucleotides.
C) amino acids.
D) proteins.
Question
Which of the following codons does NOT code for an amino acid? <strong>Which of the following codons does NOT code for an amino acid?  </strong> A) UGA B) AUG C) GAU D) UAC <div style=padding-top: 35px>

A) UGA
B) AUG
C) GAU
D) UAC
Question
In the genetic code,a codon is ________ bases long for ________.

A) two; all cell types
B) three; all cell types
C) three; bacterial cells and two bases long for plant cells
D) three; plant cells and three bases long for bacterial cells
Question
Which of the following is NOT a feature of the genetic code?

A) Every individual has a different genetic code.
B) Each codon in the genetic code specifies only one amino acid.
C) The genetic code is redundant.
D) The same genetic code can be applied to virtually every organism on Earth.
Question
Gene expression is

A) nonvariable for cells; it is the same for all cells of the same type.
B) highly variable; it changes for many different reasons throughout the life of a cell.
C) set by internal factors early in the life cycle of a cell and remains the same from that point forward.
D) set by external factors early in the life cycle of a cell and remains the same from that point forward.
Question
In humans the tRNA with the anticodon AAU carries the amino acid leucine.In plants,this tRNA would

A) not have an anticodon.
B) not carry an amino acid.
C) carry the same amino acid.
D) carry a different amino acid.
Question
If a molecule of mRNA is a sentence,its bases are the letters and the codons are the ________.
Question
Gene regulation is the ability to

A) cut out a certain region of DNA to save energy.
B) increase or decrease protein synthesis from a given gene.
C) change the sequence of a gene to produce a new protein.
D) share genetic information between different organisms.
Question
Transforming plants with a human gene produces a protein that is identical to the original human protein.Explain how this evidence demonstrates that the genetic code is universal,and list another experiment that could be used to further support this theory.
Question
The expression of most genes is regulated by

A) internal signals only.
B) external signals only.
C) both internal and external signals.
D) neither internal nor external signals.
Question
In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result,

A) more mRNA for aromatase is produced.
B) less mRNA for aromatase is produced.
C) the production of aromatase is inhibited.
D) aromatase is degraded by other enzymes in the cell.
Question
A gene in a region of DNA that is wound more tightly around proteins in the nucleus will be

A) transcribed more often than other genes.
B) transcribed less often than other genes.
C) transcribed equally as often as any other gene.
D) digested and recycled to produce new DNA.
Question
A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end.This molecule is most likely a ________ molecule.
Question
A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.
Question
The process of using an RNA template to make proteins is called ________.
Question
A tRNA with the anticodon GGG would have the amino acid ________ bound to it.
A tRNA with the anticodon GGG would have the amino acid ________ bound to it.  <div style=padding-top: 35px>
Question
A mutation in the promoter region of a specific gene prevents RNA polymerase from binding.How would this mutation affect the function of this gene?
Question
Liver cells are different from heart cells of the same organism because these cell types

A) have different genes.
B) express different genes.
C) have a different DNA sequence.
D) mutated from a stem cell to produce new cell types.
Question
The genetic code is ________,which means that all cells use the same code.
Question
In bacteria,a particular gene codes for a protein that helps the bacteria break down and use lactose as a food source.If no lactose is present,the

A) gene will be broken down, so no enzyme is made.
B) gene will mutate to produce another, more useful, enzyme.
C) promoter for this gene will be blocked, so RNA polymerase can't bind.
D) promoter for this gene will be enhanced, so RNA polymerase binds more readily.
Question
Explain how different cells in a human body,such as liver cells and skin cells,house the same genetic material but have different functions.
Question
Since 1900,at least ________ people worldwide have died as a result of an H1N1 influenza infection. <strong>Since 1900,at least ________ people worldwide have died as a result of an H1N1 influenza infection.  </strong> A) 50,000,000 B) 50,285,000 C) 650,000 D) 52,535,000 <div style=padding-top: 35px>

A) 50,000,000
B) 50,285,000
C) 650,000
D) 52,535,000
Question
DNA viruses cause disease when the host cell uses the viral DNA to produce more viruses.The host cell uses the viral DNA to make viral proteins as well as more viral DNA; these are then used to produce more viruses and cause disease.In a eukaryotic cell,the viral DNA is often inserted into the host genome.Explain why viral DNA that stays in the cytoplasm would not cause disease.
Question
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
More ribosomes are produced.
Question
Explain what is meant by "redundancy" in the genetic code.
Question
Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.
Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.  <div style=padding-top: 35px>
Question
One concern with biopharming is that genes used to produce desired proteins could "escape" a laboratory setting and spread to food crops.What does it mean for a gene to "escape?" How would food crops be affected?
Question
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
mRNA
Question
A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?
A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?  <div style=padding-top: 35px>
Question
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
The mRNA molecules are broken down quickly in the cytoplasm.
Question
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
Fewer RNA polymerase enzymes are produced.
Question
Organisms can regulate both transcription and translation to control gene expression.What is one advantage and one disadvantage of regulating transcription rather than translation?
Question
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
RNA polymerase binds to the promoter more easily.
Question
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
RNA polymerase
Question
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
Fewer tRNA molecules are produced.
Question
A silent mutation is a mutation where a DNA nucleotide has changed,but the resulting protein is identical to the protein produced before the mutation.Explain why such a mutation is possible.
Question
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
amino acids
Question
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
tRNA
Question
Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.
Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.  <div style=padding-top: 35px>
Question
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
rRNA
Question
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
DNA
Question
Bacteria do not have a nucleus,and therefore do not use RNA splicing after translation.The initial mRNA that is produced is translated directly.An experiment transforms a bacterial cell and a eukaryotic cell with an identical gene (of identical length).Explain how the proteins from each cell would differ.
Question
A mutation that changes the anticodon of a tRNA is generally much more detrimental to a cell than a mutation that changes the codon of an mRNA.Explain why this might be the case.
Unlock Deck
Sign up to unlock the cards in this deck!
Unlock Deck
Unlock Deck
1/98
auto play flashcards
Play
simple tutorial
Full screen (f)
exit full mode
Deck 10: How Genes Work
1
The key enzyme used during transcription is

A) RNA polymerase.
B) DNA polymerase.
C) rRNA.
D) terminase.
A
2
Which of the following is true of transcription?

A) It destroys the DNA template.
B) The DNA molecule must unwind.
C) Base pairing is unimportant.
D) The end result is a protein.
B
3
Which of the following does NOT take place in the nucleus?

A) transcription
B) intron removal
C) DNA replication
D) translation
D
4
As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

A) promoter.
B) intron.
C) start codon.
D) anticodon.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
5
DNA technology can be used with all organisms because they all

A) contain antibodies.
B) can contract the same diseases.
C) share the same chemical DNA structure.
D) contain the same genes.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
6
Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei.Therefore,prokaryotic

A) cells are unable to undergo transcription and translation.
B) cells do not need to undergo translation.
C) cells do not need to undergo transcription.
D) transcription and translation both take place in the cytoplasm.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
7
The bases present in an RNA molecule are

A) C, T, A, and G.
B) U, A, C, and G.
C) G, C, U, and T.
D) U, C, T, and A.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
8
Protein-coding genes specify the production of ________ as their immediate product.

A) rRNA
B) tRNA
C) DNA
D) mRNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
9
During transcription,

A) the DNA strands replicate, producing four mRNA molecules.
B) each strand in the DNA molecule directs the production of an mRNA molecule.
C) a template strand of DNA directs the production of an mRNA molecule.
D) a template strand of DNA directs the production of a tRNA molecule.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
10
Bacteria and humans use the same DNA components,and both kinds of cells also perform transcription and translation.Which of the following choices is a potentially significant outcome of this shared mechanism?

A) Bacteria are able to transcribe and translate human DNA, and thus they potentially could produce human proteins.
B) Bacteria are able to transcribe and translate human DNA; thus, they could evolve into humans.
C) Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same.
D) Bacterial and human DNA are identical in sequence because the method for producing them is the same.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
11
A mutation occurs in the promoter of a protein-encoding gene.How might this mutation affect the production of the protein encoded by the gene?

A) The mRNA made from this gene would exhibit the same mutation and, therefore, would not fold or function properly.
B) The protein made from the promoter would have a different amino acid sequence and, therefore, would not function properly.
C) The promoter might not be recognized by RNA polymerase, so the enzyme would be unable to attach to the promoter and start transcription.
D) The start codon would be missing from the mRNA made from this gene, so the mRNA could not be translated.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
12
Some viruses produce an enzyme called reverse transcriptase which causes the reverse process of transcription.Based on your understanding of gene expression,this enzyme should produce ________ from a(n)________ template.

A) RNA; DNA
B) DNA; RNA
C) proteins; RNA
D) RNA; protein
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
13
In bacteria,the antibiotic chloramphenicol prevents amino acids from bonding.The MOST likely reason that bacteria die from treatment with chloramphenicol is because the antibiotic

A) inhibits transcription.
B) inhibits translation.
C) causes the wrong bases to be added to the growing mRNA strand.
D) causes the wrong amino acids to be bound to the tRNA strands.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
14
The information in a gene is encoded by the

A) introns of eukaryotic cells.
B) amino acids that make up the genes.
C) base sequences of the gene's DNA.
D) rRNA that transfers amino acids to ribosomes.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
15
If a strand of DNA has the sequence CGTAA,the RNA made from this molecule will have the sequence

A) CGTAA.
B) GCUTT.
C) TAGCC.
D) GCAUU.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
16
The function of genes is to control the production of

A) enzymes.
B) structural proteins.
C) all proteins.
D) amino acids.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
17
In bacteria,the antibiotic erythromycin prevents ribosomes from functioning.The MOST likely reason that bacteria die from treatment with erythromycin is because the antibiotic

A) inhibits transcription.
B) inhibits translation.
C) causes the wrong bases to be added to the growing mRNA strand.
D) causes the wrong amino acids to be bound to the tRNA strands.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
18
The order of the bases in DNA determines the order of the

A) amino acids in DNA.
B) bases in a protein.
C) amino acids in mRNA.
D) bases in mRNA.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
19
Following transcription,the

A) strands of DNA bond back to each other.
B) mRNA is digested.
C) DNA molecule is broken down.
D) ribosome is released from the tRNA molecule.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
20
A human gene put into a plant cell will

A) not produce a protein.
B) produce a plant protein.
C) produce the same protein produced in a human cell.
D) produce a hybrid protein consisting of both human and plant components.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
21
Which of the following codons codes for proline? <strong>Which of the following codons codes for proline?  </strong> A) UCC B) CCU C) UUU D) CUU

A) UCC
B) CCU
C) UUU
D) CUU
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
22
Which of the lettered arrows in the diagram below of translation indicates a codon? <strong>Which of the lettered arrows in the diagram below of translation indicates a codon?  </strong> A) A B) B C) C D) D

A) A
B) B
C) C
D) D
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
23
Which of the following is a codon?

A) U
B) UU
C) UUU
D) UUUU
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
24
Which molecules are involved in translation?

A) DNA and RNA
B) mDNA, tDNA, and rDNA
C) mRNA, tRNA, and rRNA
D) proteins, amino acids, and DNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
25
Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA? <strong>Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA?  </strong> A) tyrosine-tyrosine-alanine B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine C) methionine-proline-glutamate D) methionine-proline-glutamate-isoleucine-alanine

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
26
Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG. <strong>Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG.  </strong> A) ACAUGCUAUAUCCCG B) ACATGCTATATCCCG C) cysteine-threonine-isoleucine-glycine D) threonine-cysteine-tyrosine-isoleucine-proline

A) ACAUGCUAUAUCCCG
B) ACATGCTATATCCCG
C) cysteine-threonine-isoleucine-glycine
D) threonine-cysteine-tyrosine-isoleucine-proline
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
27
Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation.In this analogy,what would best match the job of the ribosome?

A) the instructions
B) the person building the bookshelf
C) the pieces of wood
D) the bookshelf
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
28
A smartphone app converts spoken English into Spanish.This is similar to the process by which ________ are converted into ________.

A) nitrogenous bases in DNA; nitrogenous bases in mRNA
B) nitrogenous bases in mRNA; a sequence of amino acids
C) amino acids in a protein; nitrogenous bases in tRNA
D) nitrogenous bases in tRNA; nitrogenous bases in mRNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
29
Which of the following is true of rRNA?

A) It is made up of base pairs.
B) It carries amino acids.
C) It is not translated.
D) It helps transcribe DNA.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
30
Which of the following codons codes for the same amino acid as the codon AGU? <strong>Which of the following codons codes for the same amino acid as the codon AGU?  </strong> A) AGA B) CGU C) UCA D) GCU

A) AGA
B) CGU
C) UCA
D) GCU
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
31
What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation? <strong>What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation?  </strong> A) UCG B) AGC C) TCC D) Serine

A) UCG
B) AGC
C) TCC
D) Serine
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
32
An mRNA molecule that is 99 bases long will create a protein composed of

A) 33 amino acids.
B) 99 amino acids.
C) 33 tRNA molecules.
D) 99 tRNA molecules.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
33
Which RNA molecule brings new amino acids to the growing protein chain in translation?

A) mRNA
B) tRNA
C) rRNA
D) dRNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
34
The codon GAU codes for which amino acid? <strong>The codon GAU codes for which amino acid?  </strong> A) CUA B) CTA C) aspartate D) leucine

A) CUA
B) CTA
C) aspartate
D) leucine
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
35
The importance of tRNA is that it

A) carries a specific amino acid to the mRNA.
B) reads the DNA molecule.
C) contains codons that specify amino acids.
D) is important in the construction of ribosomes.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
36
During translation,

A) many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein.
B) one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein.
C) strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein.
D) one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
37
In bacteria,the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome.The MOST likely reason that bacteria die from treatment with tetracycline is because the antibiotic

A) inhibits the cell from producing the mRNA.
B) causes the tRNA molecules to randomly arrange into proteins that do not function.
C) causes tRNA rather than mRNA to be made into proteins.
D) prevents the bacteria from assembling essential proteins.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
38
Each set of three bases in an mRNA molecule codes for one of 20 specific

A) rRNA molecules.
B) nucleotides.
C) amino acids.
D) proteins.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
39
Which of the following codons does NOT code for an amino acid? <strong>Which of the following codons does NOT code for an amino acid?  </strong> A) UGA B) AUG C) GAU D) UAC

A) UGA
B) AUG
C) GAU
D) UAC
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
40
In the genetic code,a codon is ________ bases long for ________.

A) two; all cell types
B) three; all cell types
C) three; bacterial cells and two bases long for plant cells
D) three; plant cells and three bases long for bacterial cells
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
41
Which of the following is NOT a feature of the genetic code?

A) Every individual has a different genetic code.
B) Each codon in the genetic code specifies only one amino acid.
C) The genetic code is redundant.
D) The same genetic code can be applied to virtually every organism on Earth.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
42
Gene expression is

A) nonvariable for cells; it is the same for all cells of the same type.
B) highly variable; it changes for many different reasons throughout the life of a cell.
C) set by internal factors early in the life cycle of a cell and remains the same from that point forward.
D) set by external factors early in the life cycle of a cell and remains the same from that point forward.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
43
In humans the tRNA with the anticodon AAU carries the amino acid leucine.In plants,this tRNA would

A) not have an anticodon.
B) not carry an amino acid.
C) carry the same amino acid.
D) carry a different amino acid.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
44
If a molecule of mRNA is a sentence,its bases are the letters and the codons are the ________.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
45
Gene regulation is the ability to

A) cut out a certain region of DNA to save energy.
B) increase or decrease protein synthesis from a given gene.
C) change the sequence of a gene to produce a new protein.
D) share genetic information between different organisms.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
46
Transforming plants with a human gene produces a protein that is identical to the original human protein.Explain how this evidence demonstrates that the genetic code is universal,and list another experiment that could be used to further support this theory.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
47
The expression of most genes is regulated by

A) internal signals only.
B) external signals only.
C) both internal and external signals.
D) neither internal nor external signals.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
48
In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result,

A) more mRNA for aromatase is produced.
B) less mRNA for aromatase is produced.
C) the production of aromatase is inhibited.
D) aromatase is degraded by other enzymes in the cell.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
49
A gene in a region of DNA that is wound more tightly around proteins in the nucleus will be

A) transcribed more often than other genes.
B) transcribed less often than other genes.
C) transcribed equally as often as any other gene.
D) digested and recycled to produce new DNA.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
50
A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end.This molecule is most likely a ________ molecule.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
51
A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
52
The process of using an RNA template to make proteins is called ________.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
53
A tRNA with the anticodon GGG would have the amino acid ________ bound to it.
A tRNA with the anticodon GGG would have the amino acid ________ bound to it.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
54
A mutation in the promoter region of a specific gene prevents RNA polymerase from binding.How would this mutation affect the function of this gene?
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
55
Liver cells are different from heart cells of the same organism because these cell types

A) have different genes.
B) express different genes.
C) have a different DNA sequence.
D) mutated from a stem cell to produce new cell types.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
56
The genetic code is ________,which means that all cells use the same code.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
57
In bacteria,a particular gene codes for a protein that helps the bacteria break down and use lactose as a food source.If no lactose is present,the

A) gene will be broken down, so no enzyme is made.
B) gene will mutate to produce another, more useful, enzyme.
C) promoter for this gene will be blocked, so RNA polymerase can't bind.
D) promoter for this gene will be enhanced, so RNA polymerase binds more readily.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
58
Explain how different cells in a human body,such as liver cells and skin cells,house the same genetic material but have different functions.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
59
Since 1900,at least ________ people worldwide have died as a result of an H1N1 influenza infection. <strong>Since 1900,at least ________ people worldwide have died as a result of an H1N1 influenza infection.  </strong> A) 50,000,000 B) 50,285,000 C) 650,000 D) 52,535,000

A) 50,000,000
B) 50,285,000
C) 650,000
D) 52,535,000
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
60
DNA viruses cause disease when the host cell uses the viral DNA to produce more viruses.The host cell uses the viral DNA to make viral proteins as well as more viral DNA; these are then used to produce more viruses and cause disease.In a eukaryotic cell,the viral DNA is often inserted into the host genome.Explain why viral DNA that stays in the cytoplasm would not cause disease.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
61
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
More ribosomes are produced.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
62
Explain what is meant by "redundancy" in the genetic code.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
63
Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.
Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
64
One concern with biopharming is that genes used to produce desired proteins could "escape" a laboratory setting and spread to food crops.What does it mean for a gene to "escape?" How would food crops be affected?
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
65
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
mRNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
66
A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?
A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
67
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
The mRNA molecules are broken down quickly in the cytoplasm.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
68
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
Fewer RNA polymerase enzymes are produced.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
69
Organisms can regulate both transcription and translation to control gene expression.What is one advantage and one disadvantage of regulating transcription rather than translation?
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
70
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
RNA polymerase binds to the promoter more easily.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
71
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
RNA polymerase
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
72
MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
Fewer tRNA molecules are produced.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
73
A silent mutation is a mutation where a DNA nucleotide has changed,but the resulting protein is identical to the protein produced before the mutation.Explain why such a mutation is possible.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
74
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
amino acids
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
75
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
tRNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
76
Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.
Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
77
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
rRNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
78
Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
DNA
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
79
Bacteria do not have a nucleus,and therefore do not use RNA splicing after translation.The initial mRNA that is produced is translated directly.An experiment transforms a bacterial cell and a eukaryotic cell with an identical gene (of identical length).Explain how the proteins from each cell would differ.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
80
A mutation that changes the anticodon of a tRNA is generally much more detrimental to a cell than a mutation that changes the codon of an mRNA.Explain why this might be the case.
Unlock Deck
Unlock for access to all 98 flashcards in this deck.
Unlock Deck
k this deck
locked card icon
Unlock Deck
Unlock for access to all 98 flashcards in this deck.