Deck 15: Translation of MRNA

Question 1

What does eIF5 act to recruit during the initiation stage?

A) the mRNA
B) the polypeptide
C) the large ribosomal subunit
D) termination GTPases
E) the 7-methylguanosine cap

Answer 1

C

Question 2

The primary structure of a protein refers to

A) regular repeating shapes, such as beta-sheets.
B) the three-dimensional shape of the protein.
C) the linear sequence of the amino acids.
D) the interaction of two or more peptide chains.

Answer 2

C

Question 3

Which of the following would be considered an activated amino acid?

A) Amino acid · ATP · aminoacyl-tRNA synthetase
B) Amino acid · aminoacyl-tRNA synthetase
C) Amino acid · AMP · PPi
D) Amino acid · AMP

Answer 3

D

Question 4

Where are the ribosomal subunits assembled?

A) nucleus
B) nucleoid
C) nucleolus
D) nuclear envelope

Question 5

A tRNA's anticodon is 5′GGC3′.What amino acid is attached to it?

A) glycine
B) proline
C) alanine
D) arginine

Question 6

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

A) 8
B) 9
C) 10
D) 11

Question 7

What level of protein structure is exemplified by α-helices and β-sheets?

A) primary structure
B) secondary structure
C) tertiary structure
D) quaternary structure

Question 8

The genetic code - the correspondence between codons and amino acids - is unique for each species of organism.

Question 9

All mature polypeptides contain a methionine at the N-terminus.

Question 10

What is responsible for binding the initiator tRNA in prokaryotes and eukaryotes?

A) IF2 / eIF2
B) EF-Tu / eEF1α
C) RF3 / eRF3
D) EF-G / eEF2

Question 11

What site does the initiator tRNA bind to on the ribosome?

A) A
B) E
C) P

Question 12

Which of the following codons is NOT degenerate to CUU?

A) CUC
B) UUG
C) CUA
D) AUU
E) UUA

Question 13

What is the least number of tRNAs needed to carry isoleucine,and what is/are the anticodon(s)?

A) one-5′IAU3′
B) one-5′UAU3′
C) two-5′GAU3′ and 5′UAU3′
D) two-5′AUA3′ and 5′UAI3′

Question 14

Francis Crick proposed the adaptor hypothesis,and later the adaptor was discovered to be ________.

A) siRNA
B) amino acid
C) tRNA
D) mRNA
E) micro RNA

Question 15

Which of the following is NOT a stop codon?

A) UGA
B) UUA
C) UAG
D) UAA

Question 16

Which molecule contains an anticodon?

A) DNA
B) mRNA
C) rRNA
D) tRNA
E) snRNA

Question 17

Kozak's rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences.In prokaryotes,the promoter consensus sequences are at −35 and −10.Where is the consensus sequence for translational initiation according to Kozak's rules?

A) −6 to +4
B) −12 to −2
C) +1 to +10
D) −35 to −10

Question 18

What site on the ribosome is primarily responsible for holding the growing polypeptide?

A) A
B) E
C) P

Question 19

61 different tRNAs are required for translation in vivo.

Question 20

A tRNA that has an amino acid attached is called ________.

A) rRNA
B) degenerate tRNA
C) coding tRNA
D) charged tRNA
E) None of the answers are correct.

Question 21

The anticodon on the mRNA recognizes the codon on the tRNA.

Question 22

Which of the following are true regarding the experiments of Beadle and Tatum?

A) They were able to create loss-of-function mutations in any enzyme they chose.
B) They used the mold Neurospora as a model organism.
C) They isolated strains that could not grow on minimal media.
D) They established the link between a gene and an enzyme or protein.

Question 23

Transcription and translation may occur simultaneously in prokaryotic cells.

Question 24

In bacteria,the sequence that facilitates the binding of the mRNA to the ribosome is called the

A) Kozak sequence.
B) Shine-Dalgarno sequence.
C) start sequence.
D) rRNA sequence.

Question 25

The first person to suggest that a connection exists between the function of a gene and the production of an enzyme was Archibald Garrod.

Question 26

The enzyme that attaches free amino acids to the tRNA molecule is called tRNA attachase.

Question 27

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Question 28

The C-terminus of a polypeptide always contains

A) a stop codon.
B) a carboxyl group.
C) an amino group.
D) carbon dioxide.
E) a stop amino acid.

Question 29

Which component of the ribosome is able to detect when the wrong tRNA has inserted into the A site?

A) 16S rRNA
B) P site
C) Shine-Dalgarno sequence
D) snRNA
E) aminoacyl-tRNA synthetase

Question 30

Which two things act together to terminate translation? (Choose two.)

A) Rho factor
B) release factor
C) stop codon
D) Met codon
E) filled P site

Question 31

The scientist(s)________ studied Neurospora mutants that were altered in their nutritional requirements and hypothesized that one gene encodes one enzyme.

A) Garrod 
B) Nirenberg and Matthaei
C) Khorana and colleagues
D) Nirenberg and Leder
E) Beadle and Tatum

Question 32

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Question 33

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

A) Alternative splicing allows one gene to encode multiple polypeptides.
B) Some genes encode RNAs, not enzymes.
C) Some genes encode lipids, not enzymes.
D) Some genes encode polypeptides that are not enzymes, such as structural proteins.
E) Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.

Question 34

RF1 and RF2 are active during ________.

A) initiation
B) elongation
C) termination
D) cotranslational import

Question 35

The peptidyltransferase complex is a component of which of the following?

A) DNA
B) tRNA
C) The ribosome
D) The growing polypeptide
E) mRNA

Question 36

The scientist(s)________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

A) Garrod 
B) Nirenberg and Matthaei
C) Khorana and colleagues
D) Nirenberg and Leder
E) Beadle and Tatum

Question 37

A polyribosome can be found in which of the following types of cells?

A) prokaryotic
B) eukaryotic
C) both

Question 38

Mitochondria import their ribosomes from the pool of ribosomes in the cytoplasm.

Question 39

The wobble base is the second base of a codon.

Question 40

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

Question 41

The scientist(s)________ developed the triplet-binding assay.Samples containing ribosomes and a particular RNA triplet were exposed to charged tRNAs with different radiolabeled amino acids.Only the amino acid whose tRNA matched the triplet would bind the ribosome.The triplet-binding assay established relationships between particular triplet sequences and specific amino acids.

A) Garrod 
B) Nirenberg and Matthaei
C) Khorana and colleagues
D) Nirenberg and Leder
E) Beadle and Tatum

Question 42

 
What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

A) 1
B) 2
C) 3
D) 4

Question 43

You perform a cell free translation experiment like Nirenberg and Matthaei.You start with 60% C and 40% A.What relative amount of radiolabeled proline do you expect in the translated polypeptides?

A) 36%
B) 22%
C) 14%
D) 28%

Question 44

The scientist(s)________ developed a novel method to synthesize RNA.Short RNAs of 2 to 4 nucleotides were linked together to create a copolymer.The resulting peptide created after translation revealed the 3-letter code for the amino acids.

A) Garrod 
B) Nirenberg and Matthaei
C) Khorana and colleagues
D) Nirenberg and Leder
E) Beadle and Tatum

Question 45

The scientist(s)________ created a cell-free translation system.An mRNA template was added to a number of tubes,each containing amino acids with a different one radiolabeled.Radiation was measured from the precipitated protein,and this corresponded to the mRNA template that had been added.This was the first experiment that demonstrated the ability to synthesize polypeptides from synthetic mRNA,and revealed a relationship between the two.

A) Garrod 
B) Nirenberg and Matthaei
C) Khorana and colleagues
D) Nirenberg and Leder
E) Beadle and Tatum

Question 46

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

A) 125 nucleotides.
B) 376 nucleotides.
C) 1128 nucleotides.
D) 3384 nucleotides.

Question 47

You perform a cell free translation experiment like Nirenberg and Matthaei,but you forget to write down what nucleotides you added to make the mRNA.You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline,25% threonine,12.5% glutamine,12.5% lysine,12.5% asparagine,and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA?

A) Equal amounts of A, C, U, and G
B) 50% C and 50% A
C) 70% C and 30% A
D) 50% C and 50% U
E) 50% A and 50% G

Question 48

 You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit? (Assume pathway intermediates are not available from sources outside the phenylalanine breakdown pathway.)

A) This person will exhibit symptoms of alkaptonuria.
B) This person will exhibit symptoms of tyrosinosis.
C) This person will exhibit symptoms of phenylketonuria.
D) This person will exhibit symptoms of alkaptonuria and phenylketonuria.
E) This person will be phenotypically normal.

Question 49

Suppose you performed a triplet binding assay with the triplet 5′-UAA-3′.What radiolabeled amino acids do you expect to find bound to the filter?

A) Tyrosine
B) Asparagine
C) Methionine
D) None

Question 50

Mutations in the enzyme homogentisic acid oxidase are associated with alkaptonuria.Select all characteristics of homogentisic acid oxidase.

A) Is encoded by a structural gene
B) Has primary, secondary, and tertiary structure
C) Has an amino-terminal and a carboxyl-terminal end
D) Catalyzes a reaction in a metabolic pathway
E) Assists other polypeptides with folding into the correct secondary structure

Question 51

 A tRNA's anticodon is 5′GGC3′.What amino acid is attached to it?

A) Glycine
B) Proline
C) Alanine
D) Arginine