Deck 20: Molecular Technologies

Full screen (f)
exit full mode
Question
Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called ________.

A) phages
B) viruses
C) plasmids
D) chromosomes
Use Space or
up arrow
down arrow
to flip the card.
Question
In a cloning experiment with chromosomal DNA,you use a vector that contains a lacZ gene as a selectable marker.If the competent cells are grown on X-Gal and IPTG,which colonies would contain cloned chromosomal DNA?

A) the white colonies
B) the blue colonies
C) half the total colonies
D) none of the colonies
Question
Restriction endonucleases recognize specific DNA sequences.
Question
What do competent cells do?

A) resist transfection by a viral vector
B) rejoin DNA strands without the aid of DNA ligase
C) utilize transposons as a vector
D) take up DNA from the external environment
Question
What is a DNA library?

A) a collection of vectors, each containing a fragment of the genome or DNA of interest
B) a complete sequence of the genetic material in an organism
C) an electronic file that may be used for additional genetic analysis
D) a collection of mRNA from a given cell
Question
Select the technique that can be used to see how a specific mutation affects the expression of a gene and the function of a protein.

A) site-directed mutagenesis
B) Western blotting
C) real-time PCR
D) DNA sequencing
Question
Which of the following is an example of a palindromic DNA sequence?

A) 5′ - ATCGAC - 3′ 3′ - TAGCAG - 5′
B) 5′ - ATCATC - 3′ 3′ - ATCATC - 5′
C) 5′ - GCCGCC - 3′ 3′ - CGGCGG - 5′
D) 5′ - CTGCAG - 3′ 3′ - GACGTC - 5′
Question
A plasmid that contains separate origins of replication for two different species is called a(n)________.

A) R factor
B) expression vector
C) viral vector
D) shuttle vector
Question
DNA ligase is needed in a cloning experiment for what reason?

A) to proofread the vector for mistakes
B) to reestablish the stable sugar-phosphate backbone of the DNA molecule
C) to allow the vector to enter into the cell
D) as a selectable marker
Question
Site-directed mutagenesis allows researchers to produce a mutation at a ________ within a cloned DNA segment.

A) specific site
B) random site
C) semilocalized site that can later be identified by sequencing
Question
What is the purpose of RT(reverse transcriptase)-PCR?

A) to conduct a PCR reaction without the use of primers
B) to follow the amount of a specific PCR product in real time
C) to quantify RNA in a cell
D) to nonspecifically amplify DNA
Question
A cDNA library differs from a genomic library in which way?

A) It consists solely of RNA molecules.
B) It contains many copies of the gene of interest.
C) It contains only coding sequences, not introns.
D) It is typically 10-100 times the size of a DNA library.
Question
What is the origin of restriction endonucleases?

A) They are part of DNA repair mechanisms in eukaryotic cells.
B) They are a defense mechanism against viruses in bacteria.
C) They are replication enzymes of yeast.
D) They are transposable elements of Drosophila.
Question
What occurs during the annealing stage of a PCR reaction?

A) The DNA strands separate
B) The DNA polymerase copies the template DNA.
C) The primers bind to the template DNA.
D) The reaction stops.
Question
What is the purpose of RNaseH in the making of cDNA?

A) It copies the RNA into a complementary DNA strand.
B) It reforms the sugar-phosphate backbone.
C) It generates short RNAs that are used as primers.
D) It proofreads the cDNA for errors.
Question
In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you wish to use site-directed mutagenesis to change the T at position 8 to a C.Select the primer that is likely to give you the best results.

A) 5′ GCGCAAACTTCCCTATACCC 3′
B) 5′ CGCGTTTGAAGGATATGGG 3′
C) 5′ GCGCAGGCCTCCCTATACCC 3′
Question
cDNA is made using what as the starting material?

A) plasmid vectors
B) viral DNA
C) chromosomal DNA
D) RNA
Question
Which of the following individual(s)developed the process of the polymerase chain reaction?

A) Watson and Crick
B) McClintock
C) Mullis
D) Pauling
Question
Which of the following would contain both vector DNA and chromosomal DNA?

A) recircularized vector
B) hybrid vector
C) both vectors
D) neither vector
Question
Select the reagents needed for PCR.Choose all that apply.

A) Template DNA
B) Primers
C) dNTPs
D) DNA Polymerase
E) RNA
Question
Which procedure is used to identify a specific protein within a mixture of many different protein molecules?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting
Question
Which of the following cells is not pluripotent?

A) embryonic stem cells
B) embryonic germ cells
C) both are pluripotent
D) neither are pluripotent
Question
You are performing a mobility shift assay with a protein complex that is composed of proteins A,B,C,& D,each of which can bind to the DNA of interest.You run the gel with the lanes as follows:
Lane 1: Protein A + DNA
Lane 2: Proteins A + B + DNA
Lane 3: Proteins A + B + C + DNA
Lane 4: Proteins A + B + C + D + DNA
In which lane will the DNA run closest to the top of the gel?

A) Lane 4
B) Lane 3
C) Lane 2
D) Lane 1
Question
In real-time PCR,the initial template concentration is calculated using the ________ phase of PCR.

A) exponential
B) linear
C) plateau
Question
Select items that describe a stage of a PCR reaction.Choose all that apply.

A) DNA is heated to a temperature that causes the strands to separate.
B) Primers bind to complementary sequences on the template DNA.
C) DNA gyrase enzyme relieves the supercoiling ahead of the replication fork.
D) The DNA polymerase synthesizes a new strand of DNA that is complementary to the template DNA.
Question
Which of the following terms describes a cell that can form any other cell of the organism?

A) pluripotent
B) totipotent
C) unipotent
D) All of the answers are correct.
Question
A vector is a small segment of DNA that a gene of interest is inserted into for cloning.
Question
Detection of a product in real-time PCR depends on

A) the separation of the reporter from the quencher.
B) the reporter and quencher remaining in close proximity to each other.
C) the reporter binding to the quencher.
D) Taq polymerase destroying the reporter.
Question
Which procedure is used to identify a specific RNA within a mixture of many RNA molecules?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting
Question
Which of the following cells are pluripotent? (Check all that apply)

A) embryonic stem cells
B) embryonic germ cells
C) neuronal cells
D) epithelial cells
E) red blood cells
Question
Which technique uses dideoxynucleotides?

A) RT-PCR
B) DNA sequencing
C) restriction digest
D) gene cloning
Question
The use of fluorescent-labeled dideoxynucleotides is a characteristic of what type of sequencing?

A) automated DNA sequencing
B) base-specific DNA cleavage
Question
Although Dolly was only three years old,her chromosomes had the length of a 9- to 10-year-old sheep.Which of the following best describes why this occurred?

A) The cell lines that created Dolly were aged prematurely in the lab and thus became longer.
B) Nonhomologous recombination occurred, which caused Dolly's chromosomes to shorten.
C) A mutation enhanced the rate of aging of Dolly's chromosomes.
D) Dolly was not a clone.
E) The telomeres of the somatic cells that Dolly originated from were already shortening.
Question
Hematopoietic stem cells are ________.

A) pluripotent
B) totipotent
C) unipotent
D) multipotent
Question
Antibodies can be used as a probe for which of the following techniques?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting
Question
Molecular biologists use restriction enzymes to amplify a specific section of DNA within the genome.
Question
Which technique is best suited to identify DNA-protein interactions?

A) Western blotting
B) PCR
C) gel mobility shift assay
D) restriction enzyme analysis
Question
Since cDNA is made from RNA,it lacks introns and contains only the coding sequence for the functional protein.
Question
The isolation and copying of a gene,usually in large quantities is called gene cloning.
Question
The first organism ever cloned by researchers was Dolly the sheep in 1997.
Question
An organism that can be regenerated from somatic cells is called multipotent.
Question
The origins of which of the following cell types creates the least amount of ethical debate?

A) embryonic germ cells
B) hematopoietic stem cells
C) embryonic stem cells
D) All of the answers are equal.
Question
Which of the following is an example of a pluripotent cell?

A) embryonic stem cells
B) red blood cells
C) fetal heart cells
D) umbilical cord blood
E) nerve cells
Question
Unipotent cells may differentiate into all other cell types of the body.
Question
The primary interest of genetic research into stem cells is the desire to clone a human being.
Question
What is a property of stem cells?

A) They can differentiate into one or more specialized cell types.
B) They can form any tissue in the body.
C) They are only capable of one to two cell divisions.
D) They will only form hematopoietic cells.
Question
Bone marrow transplants typically use what type of cells?

A) embryonic stem cells
B) embryonic germ cells
C) hematopoietic stem cells
D) None of the answers are correct.
Unlock Deck
Sign up to unlock the cards in this deck!
Unlock Deck
Unlock Deck
1/47
auto play flashcards
Play
simple tutorial
Full screen (f)
exit full mode
Deck 20: Molecular Technologies
1
Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called ________.

A) phages
B) viruses
C) plasmids
D) chromosomes
C
2
In a cloning experiment with chromosomal DNA,you use a vector that contains a lacZ gene as a selectable marker.If the competent cells are grown on X-Gal and IPTG,which colonies would contain cloned chromosomal DNA?

A) the white colonies
B) the blue colonies
C) half the total colonies
D) none of the colonies
A
3
Restriction endonucleases recognize specific DNA sequences.
True
4
What do competent cells do?

A) resist transfection by a viral vector
B) rejoin DNA strands without the aid of DNA ligase
C) utilize transposons as a vector
D) take up DNA from the external environment
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
5
What is a DNA library?

A) a collection of vectors, each containing a fragment of the genome or DNA of interest
B) a complete sequence of the genetic material in an organism
C) an electronic file that may be used for additional genetic analysis
D) a collection of mRNA from a given cell
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
6
Select the technique that can be used to see how a specific mutation affects the expression of a gene and the function of a protein.

A) site-directed mutagenesis
B) Western blotting
C) real-time PCR
D) DNA sequencing
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
7
Which of the following is an example of a palindromic DNA sequence?

A) 5′ - ATCGAC - 3′ 3′ - TAGCAG - 5′
B) 5′ - ATCATC - 3′ 3′ - ATCATC - 5′
C) 5′ - GCCGCC - 3′ 3′ - CGGCGG - 5′
D) 5′ - CTGCAG - 3′ 3′ - GACGTC - 5′
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
8
A plasmid that contains separate origins of replication for two different species is called a(n)________.

A) R factor
B) expression vector
C) viral vector
D) shuttle vector
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
9
DNA ligase is needed in a cloning experiment for what reason?

A) to proofread the vector for mistakes
B) to reestablish the stable sugar-phosphate backbone of the DNA molecule
C) to allow the vector to enter into the cell
D) as a selectable marker
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
10
Site-directed mutagenesis allows researchers to produce a mutation at a ________ within a cloned DNA segment.

A) specific site
B) random site
C) semilocalized site that can later be identified by sequencing
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
11
What is the purpose of RT(reverse transcriptase)-PCR?

A) to conduct a PCR reaction without the use of primers
B) to follow the amount of a specific PCR product in real time
C) to quantify RNA in a cell
D) to nonspecifically amplify DNA
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
12
A cDNA library differs from a genomic library in which way?

A) It consists solely of RNA molecules.
B) It contains many copies of the gene of interest.
C) It contains only coding sequences, not introns.
D) It is typically 10-100 times the size of a DNA library.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
13
What is the origin of restriction endonucleases?

A) They are part of DNA repair mechanisms in eukaryotic cells.
B) They are a defense mechanism against viruses in bacteria.
C) They are replication enzymes of yeast.
D) They are transposable elements of Drosophila.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
14
What occurs during the annealing stage of a PCR reaction?

A) The DNA strands separate
B) The DNA polymerase copies the template DNA.
C) The primers bind to the template DNA.
D) The reaction stops.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
15
What is the purpose of RNaseH in the making of cDNA?

A) It copies the RNA into a complementary DNA strand.
B) It reforms the sugar-phosphate backbone.
C) It generates short RNAs that are used as primers.
D) It proofreads the cDNA for errors.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
16
In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you wish to use site-directed mutagenesis to change the T at position 8 to a C.Select the primer that is likely to give you the best results.

A) 5′ GCGCAAACTTCCCTATACCC 3′
B) 5′ CGCGTTTGAAGGATATGGG 3′
C) 5′ GCGCAGGCCTCCCTATACCC 3′
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
17
cDNA is made using what as the starting material?

A) plasmid vectors
B) viral DNA
C) chromosomal DNA
D) RNA
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
18
Which of the following individual(s)developed the process of the polymerase chain reaction?

A) Watson and Crick
B) McClintock
C) Mullis
D) Pauling
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
19
Which of the following would contain both vector DNA and chromosomal DNA?

A) recircularized vector
B) hybrid vector
C) both vectors
D) neither vector
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
20
Select the reagents needed for PCR.Choose all that apply.

A) Template DNA
B) Primers
C) dNTPs
D) DNA Polymerase
E) RNA
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
21
Which procedure is used to identify a specific protein within a mixture of many different protein molecules?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
22
Which of the following cells is not pluripotent?

A) embryonic stem cells
B) embryonic germ cells
C) both are pluripotent
D) neither are pluripotent
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
23
You are performing a mobility shift assay with a protein complex that is composed of proteins A,B,C,& D,each of which can bind to the DNA of interest.You run the gel with the lanes as follows:
Lane 1: Protein A + DNA
Lane 2: Proteins A + B + DNA
Lane 3: Proteins A + B + C + DNA
Lane 4: Proteins A + B + C + D + DNA
In which lane will the DNA run closest to the top of the gel?

A) Lane 4
B) Lane 3
C) Lane 2
D) Lane 1
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
24
In real-time PCR,the initial template concentration is calculated using the ________ phase of PCR.

A) exponential
B) linear
C) plateau
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
25
Select items that describe a stage of a PCR reaction.Choose all that apply.

A) DNA is heated to a temperature that causes the strands to separate.
B) Primers bind to complementary sequences on the template DNA.
C) DNA gyrase enzyme relieves the supercoiling ahead of the replication fork.
D) The DNA polymerase synthesizes a new strand of DNA that is complementary to the template DNA.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
26
Which of the following terms describes a cell that can form any other cell of the organism?

A) pluripotent
B) totipotent
C) unipotent
D) All of the answers are correct.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
27
A vector is a small segment of DNA that a gene of interest is inserted into for cloning.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
28
Detection of a product in real-time PCR depends on

A) the separation of the reporter from the quencher.
B) the reporter and quencher remaining in close proximity to each other.
C) the reporter binding to the quencher.
D) Taq polymerase destroying the reporter.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
29
Which procedure is used to identify a specific RNA within a mixture of many RNA molecules?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
30
Which of the following cells are pluripotent? (Check all that apply)

A) embryonic stem cells
B) embryonic germ cells
C) neuronal cells
D) epithelial cells
E) red blood cells
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
31
Which technique uses dideoxynucleotides?

A) RT-PCR
B) DNA sequencing
C) restriction digest
D) gene cloning
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
32
The use of fluorescent-labeled dideoxynucleotides is a characteristic of what type of sequencing?

A) automated DNA sequencing
B) base-specific DNA cleavage
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
33
Although Dolly was only three years old,her chromosomes had the length of a 9- to 10-year-old sheep.Which of the following best describes why this occurred?

A) The cell lines that created Dolly were aged prematurely in the lab and thus became longer.
B) Nonhomologous recombination occurred, which caused Dolly's chromosomes to shorten.
C) A mutation enhanced the rate of aging of Dolly's chromosomes.
D) Dolly was not a clone.
E) The telomeres of the somatic cells that Dolly originated from were already shortening.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
34
Hematopoietic stem cells are ________.

A) pluripotent
B) totipotent
C) unipotent
D) multipotent
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
35
Antibodies can be used as a probe for which of the following techniques?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
36
Molecular biologists use restriction enzymes to amplify a specific section of DNA within the genome.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
37
Which technique is best suited to identify DNA-protein interactions?

A) Western blotting
B) PCR
C) gel mobility shift assay
D) restriction enzyme analysis
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
38
Since cDNA is made from RNA,it lacks introns and contains only the coding sequence for the functional protein.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
39
The isolation and copying of a gene,usually in large quantities is called gene cloning.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
40
The first organism ever cloned by researchers was Dolly the sheep in 1997.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
41
An organism that can be regenerated from somatic cells is called multipotent.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
42
The origins of which of the following cell types creates the least amount of ethical debate?

A) embryonic germ cells
B) hematopoietic stem cells
C) embryonic stem cells
D) All of the answers are equal.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
43
Which of the following is an example of a pluripotent cell?

A) embryonic stem cells
B) red blood cells
C) fetal heart cells
D) umbilical cord blood
E) nerve cells
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
44
Unipotent cells may differentiate into all other cell types of the body.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
45
The primary interest of genetic research into stem cells is the desire to clone a human being.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
46
What is a property of stem cells?

A) They can differentiate into one or more specialized cell types.
B) They can form any tissue in the body.
C) They are only capable of one to two cell divisions.
D) They will only form hematopoietic cells.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
47
Bone marrow transplants typically use what type of cells?

A) embryonic stem cells
B) embryonic germ cells
C) hematopoietic stem cells
D) None of the answers are correct.
Unlock Deck
Unlock for access to all 47 flashcards in this deck.
Unlock Deck
k this deck
locked card icon
Unlock Deck
Unlock for access to all 47 flashcards in this deck.