Deck 20: Molecular Technologies

Question 1

Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called ________.

A) phages
B) viruses
C) plasmids
D) chromosomes

Answer 1

C

Question 2

In a cloning experiment with chromosomal DNA,you use a vector that contains a lacZ gene as a selectable marker.If the competent cells are grown on X-Gal and IPTG,which colonies would contain cloned chromosomal DNA?

A) the white colonies
B) the blue colonies
C) half the total colonies
D) none of the colonies

Answer 2

A

Question 3

Restriction endonucleases recognize specific DNA sequences.

Answer 3

True

Question 4

What do competent cells do?

A) resist transfection by a viral vector
B) rejoin DNA strands without the aid of DNA ligase
C) utilize transposons as a vector
D) take up DNA from the external environment

Question 5

What is a DNA library?

A) a collection of vectors, each containing a fragment of the genome or DNA of interest
B) a complete sequence of the genetic material in an organism
C) an electronic file that may be used for additional genetic analysis
D) a collection of mRNA from a given cell

Question 6

Select the technique that can be used to see how a specific mutation affects the expression of a gene and the function of a protein.

A) site-directed mutagenesis
B) Western blotting
C) real-time PCR
D) DNA sequencing

Question 7

Which of the following is an example of a palindromic DNA sequence?

A) 5′ - ATCGAC - 3′ 3′ - TAGCAG - 5′
B) 5′ - ATCATC - 3′ 3′ - ATCATC - 5′
C) 5′ - GCCGCC - 3′ 3′ - CGGCGG - 5′
D) 5′ - CTGCAG - 3′ 3′ - GACGTC - 5′

Question 8

A plasmid that contains separate origins of replication for two different species is called a(n)________.

A) R factor
B) expression vector
C) viral vector
D) shuttle vector

Question 9

DNA ligase is needed in a cloning experiment for what reason?

A) to proofread the vector for mistakes
B) to reestablish the stable sugar-phosphate backbone of the DNA molecule
C) to allow the vector to enter into the cell
D) as a selectable marker

Question 10

Site-directed mutagenesis allows researchers to produce a mutation at a ________ within a cloned DNA segment.

A) specific site
B) random site
C) semilocalized site that can later be identified by sequencing

Question 11

What is the purpose of RT(reverse transcriptase)-PCR?

A) to conduct a PCR reaction without the use of primers
B) to follow the amount of a specific PCR product in real time
C) to quantify RNA in a cell
D) to nonspecifically amplify DNA

Question 12

A cDNA library differs from a genomic library in which way?

A) It consists solely of RNA molecules.
B) It contains many copies of the gene of interest.
C) It contains only coding sequences, not introns.
D) It is typically 10-100 times the size of a DNA library.

Question 13

What is the origin of restriction endonucleases?

A) They are part of DNA repair mechanisms in eukaryotic cells.
B) They are a defense mechanism against viruses in bacteria.
C) They are replication enzymes of yeast.
D) They are transposable elements of Drosophila.

Question 14

What occurs during the annealing stage of a PCR reaction?

A) The DNA strands separate
B) The DNA polymerase copies the template DNA.
C) The primers bind to the template DNA.
D) The reaction stops.

Question 15

What is the purpose of RNaseH in the making of cDNA?

A) It copies the RNA into a complementary DNA strand.
B) It reforms the sugar-phosphate backbone.
C) It generates short RNAs that are used as primers.
D) It proofreads the cDNA for errors.

Question 16

In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you wish to use site-directed mutagenesis to change the T at position 8 to a C.Select the primer that is likely to give you the best results.

A) 5′ GCGCAAACTTCCCTATACCC 3′
B) 5′ CGCGTTTGAAGGATATGGG 3′
C) 5′ GCGCAGGCCTCCCTATACCC 3′

Question 17

cDNA is made using what as the starting material?

A) plasmid vectors
B) viral DNA
C) chromosomal DNA
D) RNA

Question 18

Which of the following individual(s)developed the process of the polymerase chain reaction?

A) Watson and Crick
B) McClintock
C) Mullis
D) Pauling

Question 19

Which of the following would contain both vector DNA and chromosomal DNA?

A) recircularized vector
B) hybrid vector
C) both vectors
D) neither vector

Question 20

Select the reagents needed for PCR.Choose all that apply.

A) Template DNA
B) Primers
C) dNTPs
D) DNA Polymerase
E) RNA

Question 21

Which procedure is used to identify a specific protein within a mixture of many different protein molecules?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting

Question 22

Which of the following cells is not pluripotent?

A) embryonic stem cells
B) embryonic germ cells
C) both are pluripotent
D) neither are pluripotent

Question 23

You are performing a mobility shift assay with a protein complex that is composed of proteins A,B,C,& D,each of which can bind to the DNA of interest.You run the gel with the lanes as follows:
Lane 1: Protein A + DNA
Lane 2: Proteins A + B + DNA
Lane 3: Proteins A + B + C + DNA
Lane 4: Proteins A + B + C + D + DNA
In which lane will the DNA run closest to the top of the gel?

A) Lane 4
B) Lane 3
C) Lane 2
D) Lane 1

Question 24

In real-time PCR,the initial template concentration is calculated using the ________ phase of PCR.

A) exponential
B) linear
C) plateau

Question 25

Select items that describe a stage of a PCR reaction.Choose all that apply.

A) DNA is heated to a temperature that causes the strands to separate.
B) Primers bind to complementary sequences on the template DNA.
C) DNA gyrase enzyme relieves the supercoiling ahead of the replication fork.
D) The DNA polymerase synthesizes a new strand of DNA that is complementary to the template DNA.

Question 26

Which of the following terms describes a cell that can form any other cell of the organism?

A) pluripotent
B) totipotent
C) unipotent
D) All of the answers are correct.

Question 27

A vector is a small segment of DNA that a gene of interest is inserted into for cloning.

Question 28

Detection of a product in real-time PCR depends on

A) the separation of the reporter from the quencher.
B) the reporter and quencher remaining in close proximity to each other.
C) the reporter binding to the quencher.
D) Taq polymerase destroying the reporter.

Question 29

Which procedure is used to identify a specific RNA within a mixture of many RNA molecules?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting

Question 30

Which of the following cells are pluripotent? (Check all that apply)

A) embryonic stem cells
B) embryonic germ cells
C) neuronal cells
D) epithelial cells
E) red blood cells

Question 31

Which technique uses dideoxynucleotides?

A) RT-PCR
B) DNA sequencing
C) restriction digest
D) gene cloning

Question 32

The use of fluorescent-labeled dideoxynucleotides is a characteristic of what type of sequencing?

A) automated DNA sequencing
B) base-specific DNA cleavage

Question 33

Although Dolly was only three years old,her chromosomes had the length of a 9- to 10-year-old sheep.Which of the following best describes why this occurred?

A) The cell lines that created Dolly were aged prematurely in the lab and thus became longer.
B) Nonhomologous recombination occurred, which caused Dolly's chromosomes to shorten.
C) A mutation enhanced the rate of aging of Dolly's chromosomes.
D) Dolly was not a clone.
E) The telomeres of the somatic cells that Dolly originated from were already shortening.

Question 34

Hematopoietic stem cells are ________.

A) pluripotent
B) totipotent
C) unipotent
D) multipotent

Question 35

Antibodies can be used as a probe for which of the following techniques?

A) Western blotting
B) Northern blotting
C) Southern blotting
D) Eastern blotting

Question 36

Molecular biologists use restriction enzymes to amplify a specific section of DNA within the genome.

Question 37

Which technique is best suited to identify DNA-protein interactions?

A) Western blotting
B) PCR
C) gel mobility shift assay
D) restriction enzyme analysis

Question 38

Since cDNA is made from RNA,it lacks introns and contains only the coding sequence for the functional protein.

Question 39

The isolation and copying of a gene,usually in large quantities is called gene cloning.

Question 40

The first organism ever cloned by researchers was Dolly the sheep in 1997.

Question 41

An organism that can be regenerated from somatic cells is called multipotent.

Question 42

The origins of which of the following cell types creates the least amount of ethical debate?

A) embryonic germ cells
B) hematopoietic stem cells
C) embryonic stem cells
D) All of the answers are equal.

Question 43

Which of the following is an example of a pluripotent cell?

A) embryonic stem cells
B) red blood cells
C) fetal heart cells
D) umbilical cord blood
E) nerve cells

Question 44

Unipotent cells may differentiate into all other cell types of the body.

Question 45

The primary interest of genetic research into stem cells is the desire to clone a human being.

Question 46

What is a property of stem cells?

A) They can differentiate into one or more specialized cell types.
B) They can form any tissue in the body.
C) They are only capable of one to two cell divisions.
D) They will only form hematopoietic cells.

Question 47

Bone marrow transplants typically use what type of cells?

A) embryonic stem cells
B) embryonic germ cells
C) hematopoietic stem cells
D) None of the answers are correct.