Deck 13: DNA Technology

Question 1

Which of the following is NOT an example of a genetically modified organism?

A) a bacterium that produces the human insulin protein
B) a virus used in gene therapy containing a "good copy" of a human gene
C) human cells isolated from a tumor and grown in a dish
D) a petunia plant that expresses human antibody proteins

Answer 1

C

Question 2

To make recombinant DNA,

A) two nonhomologous chromosomes are induced to undergo crossing-over during meiosis.
B) the entire genome of one organism is fused to a plasmid.
C) pieces of DNA from different organisms are cut with restriction enzymes and then joined together.
D) DNA polymerase is used to make multiple copies of the DNA sequences of two organisms at the same time.

Answer 2

C

Question 3

To clone a recombinant plasmid,you would

A) insert the plasmid into a virus and inject the virus into a human cell.
B) allow bacteria to take up the plasmid and copy it many times.
C) mix the plasmid with restriction enzymes and nucleotides.
D) use ligase to fuse the ends of the plasmids together.

Answer 3

B

Question 4

Suspect DNA is isolated from a murder scene.The DNA is used to create a DNA fingerprint for the suspect,but it does not match the DNA fingerprint of any of the known suspects,and it does not have a match in CODIS.The murderer is not identified and the crime remains unsolved.Although there are no matches,forensic officers enter the murder scene DNA fingerprint into CODIS because

A) it may exonerate someone who was wrongly imprisoned for another crime.
B) a match may be entered into CODIS at a later date,solving the case.
C) it may be used in a paternity suit.
D) making it public will help civilians solve the case.

Question 5

A scientist isolates genomic DNA from a human cell.She needs to physically separate a specific segment of that DNA away from the rest.Which technology will allow her to do this?

A) DNA microarrays
B) genetic engineering
C) restriction enzymes
D) recombinant DNA

Question 6

Why are housekeeping genes not used to create DNA fingerprints?

A) They mutate often because they are unnecessary genes and so are highly variable.
B) They are important genes for every cell in every person and so are highly conserved.
C) They are found only in a few cell types,not all cell types.
D) They are expressed at a low rate in cells.

Question 7

This graph shows that genetically modified salmon ________ than unmodified salmon.

A) breed more quickly
B) are,at maturity,larger
C) reach a body weight of 4,000 grams faster
D) do more harm to native insect populations

Question 8

You are shown the following result of gel electrophoresis.Column 1 represents the suspect's blood.Column 2 represents the victim's blood.Which column represents a mixture of the suspect's and victim's blood?

A) 3
B) 4
C) 5
D) A mixture is not represented in this DNA fingerprint.

Question 9

In order to study a gene,a scientist needs to make many copies of that gene using

A) gene therapy.
B) DNA microarrays.
C) restriction enzymes.
D) the polymerase chain reaction.

Question 10

You are shown the following result of gel electrophoresis.Column 1 represents blood found on the arm of a crime victim,but it is not the victim's blood.The other columns are blood taken from various suspects.Which suspect's blood was found on the victim's arm?

A) 2
B) 3
C) 4
D) 5

Question 11

Deliberately transferring a gene from one species to another is an example of

A) constructing a gene library.
B) genetic engineering.
C) the polymerase chain reaction.
D) cloning.

Question 12

In comparison to DNA technology,selective breeding is

A) less precise and slower.
B) faster and more direct.
C) slower and more accurate.
D) faster and safer.

Question 13

Cloning is useful because it

A) repairs broken DNA.
B) mixes the DNA from two different organisms.
C) produces many copies of recombinant DNA.
D) determines the base sequence of a gene.

Question 14

Which of the following is the best way to make many copies of a vector containing recombinant DNA?

A) polymerase chain reaction
B) DNA hybridization
C) reproductive cloning
D) DNA cloning

Question 15

Which of the following is NOT an example of humans changing the DNA of an organism?

A) treating a patient with a medication that cures an infection
B) adding a disease-resistant gene to a crop plant
C) modifying bacteria to produce human insulin
D) gene therapy

Question 16

To produce a recombinant subunit vaccine,genes from an infectious microbe are genetically engineered into bacteria or yeast.The protein products of the transgenic infectious microbe genes are

A) antigens.
B) plasmids.
C) vectors.
D) restriction enzymes.

Question 17

A vector is used to "ferry" DNA from one organism into another.In gene therapy,what acts as the vector?

A) a virus
B) a plasmid
C) a restriction enzyme
D) a genetically modified organism

Question 18

When the FBI investigates crimes with DNA evidence,they compare 13 different noncoding regions of the human genome between the DNA evidence and the suspect.Why is it important to look at so many regions?

A) Repeating the test in different areas of the DNA ensures that the investigator did not make any mistakes in determining the DNA sequence.
B) Most regions of the human genome are identical,so you have to look in many locations to make sure you find a region that shows differences.
C) The more regions of the DNA you examine,the less likely you are to run into a coincidental similarity between DNA sequences.
D) Restriction enzymes only work in these 13 regions of the human genome.

Question 19

The use of DNA analysis to identify individuals is known as

A) PCR testing.
B) DNA fingerprinting.
C) genetic modification.
D) cloning.

Question 20

Researchers commonly use DNA technology to create recombinant DNA that has a "glowing" protein product.Which of the following is a benefit of this technology?

A) This technology provides proof to nonscientists that genetic engineering is safe.
B) Organisms that express this gene can obtain energy through photosynthesis rather than consumption.
C) The genes for glowing proteins are easier to clone than other genes.
D) Glowing proteins allow scientists to see where a particular gene is expressed in living cells.

Question 21

Mammalian pluripotent stem cells can produce all

A) cell types found in an organism.
B) cell types found in an organism,except the protective membranes that surround the embryo.
C) cell types found in the organ of their origin.
D) somatic cells found in an organism but not the reproductive germ cells.

Question 22

Bt-corn has been genetically engineered to express an insect-killing gene from the bacteria Bacillus thuringiensis.How does this genetically engineered corn benefit the environment?

A) It provides a food source for important pollinator insects.
B) It decreases the amount of land necessary to grow the world's corn requirements.
C) It increases the amount of insecticide that needs to be used on the crops.
D) It decreases the amount of insecticide that needs to be used on the crops.

Question 23

The immune disorder adenosine deaminase (ADA)deficiency is the result of a mutation in one gene.How could gene therapy be used to treat this disorder?

A) Red blood cells could be induced to produce the protein encoded by the mutated ADA gene.
B) Cells containing a corrected ADA gene could be injected into patients with ADA.
C) The patients could swallow synthetic blood cells.
D) Patients could be injected with a hybrid molecule made of the DNA and RNA of the normal ADA gene.

Question 24

In the X-SCID gene therapy trial in which some of the patients developed leukemia,the "good copy" of the gene probably inserted near a(n)________ gene.

A) short tandem repeat
B) immune system
C) housekeeping
D) tumor promoter

Question 25

Potatoes have been engineered to produce proteins from the bacteria that causes cholera,a diarrheal disease.This is an example of genetic engineering to

A) enhance economically important species.
B) produce pharmaceutical products.
C) produce vaccines.
D) produce dangerous organisms.

Question 26

Cloned animals are genetically identical to the

A) somatic cell donor
B) enucleated egg donor
C) surrogate mother
D) surrogate mother's mate

Question 27

It is better to reproductively clone animals that have useful characteristics instead of breeding them in the traditional way because

A) the embryo develops more quickly when it is reproductively cloned.
B) the variation caused by sexual reproduction may affect the useful characteristic in traditional breeding.
C) the reproductively cloned embryo requires less DNA because it is haploid.
D) a traditionally bred animal requires more food.

Question 28

Human gene therapy involves

A) introducing a functioning copy of the defective gene into the patient.
B) using plasmids to carry genes that will break down a specific harmful gene in a patient.
C) inserting genes from other organisms into the human genome.
D) using PCR to produce large amounts of normal DNA that can be injected into a patient.

Question 29

The least controversial source of human pluripotent stem cells is from

A) the inner cell mass of an embryo.
B) donated in vitro blastocysts.
C) cord blood from a newborn.
D) somatic cells induced with four proteins.

Question 30

Which of the following is NOT required for reproductive cloning?

A) an egg cell that lacks a nucleus
B) a somatic cell
C) an electrical current
D) a restriction enzyme

Question 31

The nuclear DNA of the embryo that results from the process shown in the following diagram

A) is identical to the nuclear DNA of the Scottish Blackface sheep.
B) is identical to the nuclear DNA of the Finn Dorset sheep.
C) is a unique mix of the nuclear DNA from both of the pictured sheep.
D) contains one full set of chromosomes from each of the pictured sheep.

Question 32

In the 1980s,biologists fused a mammary cell of an adult sheep into an enucleated,unfertilized egg of a second sheep and treated it with chemicals,causing it to grow into an embryo.After implantation in the uterus of a third sheep,the embryo grew to become a fully complete baby lamb.What term best describes the growth potential of that fused mammary cell and enucleated egg?

A) totipotent
B) pluripotent
C) multipotent
D) unipotent

Question 33

Human males continuously produce sperm and remain fertile throughout their lives;this ability is most likely the result of

A) conversion of testicular tissue into induced pluripotent stem cells.
B) differentiation of surplus cell types,such as red blood cells,into sperm.
C) the ability of adult stem cells in the testes to regenerate themselves throughout the life of a male.
D) totipotent cells in the testes constantly undergoing meiosis.

Question 34

In reproductive cloning,if the egg cell was not enucleated before it was fused to the somatic cell,the embryo that developed would have ________ set(s)of chromosomes.

A) 1
B) 2
C) 3
D) 4

Question 35

In the following diagram,the electrical pulse fuses the enucleated egg from one sheep and the somatic mammary cell from another sheep.This fused cell is most similar to a ________ formed during normal sexual reproduction.

A) somatic cell
B) meiotic germ cell
C) gamete
D) zygote

Question 36

Tissue containing totipotent embryonic stem cells is difficult to obtain;what is the usual source?

A) donated blastocysts produced by in vitro fertilization for women seeking fertility treatment
B) tissues from spontaneous miscarriage during the first trimester of pregnancy
C) blood and tissues extracted from the placenta after the birth of the fetus
D) cloned embryos produced by fusing a somatic cell with an enucleated egg cell

Question 37

RNA interference would be most useful as a treatment in which of the following scenarios?

A) homozygous expression of the defective hemoglobin gene in sickle cell anemia
B) lack of expression of the chloride channel gene in cystic fibrosis
C) death of insulin-producing cells in type 1 diabetes
D) overexpression of inflammatory genes in Crohn disease

Question 38

Stem cells display two unique characteristics: the ability to ________ and ________.

A) produce vaccines;produce insulin
B) cut DNA into smaller pieces;accept recombinant plasmids
C) express genes;synthesize proteins
D) differentiate into a variety of cell types;divide repeatedly

Question 39

In the following photograph,which letter correctly identifies the inner cell mass?

A) A
B) B
C) C
D) The inner cell mass is not labeled in this picture.

Question 40

Skin graft tissue grown from the skin stem cells of a burn victim is an example of

A) regenerative medicine.
B) reproductive cloning.
C) genetic engineering.
D) DNA fingerprinting.

Question 41

DNA that contains genetic information from two different sources is ________ DNA.

Question 42

In research,restriction enzymes are used to

A) stop replication of DNA at a specific base during DNA sequencing.
B) cut DNA molecules into pieces that can be used to create recombinant DNA.
C) measure the relative amounts of each base in a DNA molecule.
D) join two fragments of DNA together to form a molecule of recombinant DNA.

Question 43

Gene therapy is described in the Biology in the News article as creating "microscopic factories" that produce missing enzymes or proteins.What provides the instructions to these microscopic factories?

A) a gene introduced to the patient's body in a recombinant virus
B) a pluripotent cell obtained from a donated blastocyst
C) four genes introduced into the patient's cells to make them totipotent
D) a protein produced by recombinant bacteria in the patient's digestive system

Question 44

Crops genetically engineered to be resistant to an herbicide might promote an increased use of that herbicide because

A) the herbicide is now an effective way to prevent weed growth without harming the crop plant.
B) the engineered crops will transfer the herbicide resistance to wild plants.
C) more farmers will be able to afford the genetically engineered seeds and so more of the crop will be planted.
D) a higher concentration of the herbicide will be needed to kill wild plant species.

Question 45

A segment of DNA in a test tube replicates and produces many copies of itself.What was probably in the test tube that enhanced this process?

A) a ligase
B) a restriction enzyme
C) DNA polymerase
D) an electric current

Question 46

To screen the genome of a bacterium for a particular gene,you would use ________that attach to complementary DNA sequences.

A) gels
B) ligases
C) DNA probes
D) restriction enzymes

Question 47

DNA polymerase is used in the laboratory to

A) perform gel electrophoresis procedures.
B) cure patients of certain genetic diseases.
C) make many copies of a DNA sequence.
D) attach DNA fragments to each other.

Question 48

The DNA for the normal hemoglobin allele and the mutant sickle-cell allele are cut with the same restriction enzyme,DdeI.The resulting DNA fragments are separated by gel electrophoresis,producing the gel shown in the following figure.Why are the patterns produced by these two alleles different?

A) The normal hemoglobin gene is cut by two restriction enzymes,but the sickle-cell anemia allele is cut by only one restriction enzyme.
B) The gene for the normal allele is much larger than the gene for sickle-cell anemia.
C) The gene for the normal allele has a sequence recognized by DdeI,but the gene for sickle-cell anemia does not.
D) The sickle-cell allele has the ability to produce ligase to repair the damage done by restriction enzymes,but the normal allele does not.

Question 49

The following figure shows the first cycle in polymerase chain reaction (PCR).

What is the role of the structure marked "P" in this figure?

A) The "P" represents the heat-tolerant DNA polymerase used in PCR to copy the gene of interest.
B) The "P" represents a sequence of DNA complementary to parts of the gene being amplified that allows DNA polymerase to attach to the gene.
C) The "P" indicates where on the DNA that DNA polymerase should terminate replication.
D) The "P" indicates the location of the promoter for the gene being amplified.

Question 50

A(n)________ is a small,circular portion of DNA that is found in bacteria and is NOT part of the main genome.

Question 51

A sample of the same DNA is placed into each of two test tubes.Each tube is treated with a restriction enzyme,and the resulting fragments are separated by gel electrophoresis,producing the gel shown in the following figure.Which of the following explains why the pattern of DNA fragments differs in these two samples?

A) Different restriction enzymes must have been used in the different tubes.
B) One tube was heated,but the other tube was not.
C) Ligase was added to one of the tubes but not the other.
D) The restriction enzyme added to the tubes cut DNA at more than one sequence.

Question 52

A detective finds a miniscule spot of blood on a murder suspect's shirt.What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

A) inserting the blood's DNA into viral DNA
B) polymerase chain reaction (PCR)
C) inserting the sample's DNA into a plasmid
D) using ligases to bond the DNA fragments together for sequencing

Question 53

Which of the following conditions is the least likely to be treated with gene therapy in the future?

A) hemophilia,in which a genetic mutation prevents the production of a clotting protein
B) a digestive system disorder in which a protein is not expressed that is necessary for the absorption of a nutrient
C) a neurodegenerative disease in which males inherit a mutated gene from their mothers
D) Turner syndrome,in which only one copy of the X chromosome is present instead of the usual two X chromosomes

Question 54

Genetically modified foods

A) have been shown to cause allergies in humans.
B) undergo extensive safety testing.
C) have no advantages compared to foods obtained by conventional breeding.
D) have only possible environmental costs,no social costs.

Question 55

Among these DNA fragments,which would move most quickly during gel electrophoresis?

A) AATAAT
B) AATAATAATAAT
C) AAATTAAT
D) AATAATAATAATAATAATAAT

Question 56

The polymerase chain reaction (PCR)is used to

A) produce many copies of a selected DNA sequence.
B) insert DNA from one organism into a new host.
C) screen for a particular gene.
D) deliver DNA products into a human patient.

Question 57

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

A) One;SmaI does not cut this piece of DNA.
B) Two;SmaI cuts this piece of DNA once.
C) Two;SmaI cuts this piece of DNA twice.
D) Four;SmaI cuts this piece of DNA four times.

Question 58

A restriction enzyme from a bacterium is able to cut a human's DNA because

A) bacteria and humans are both prokaryotes.
B) all organisms use the same DNA nucleotides.
C) bacteria and humans have identical genomes.
D) a given restriction enzyme can cut DNA at several different sequences.

Question 59

The DNA primers used in PCR are

A) identical to the entire base sequence of one strand of the DNA.
B) produced when a gene of interest is read by restriction enzymes.
C) attached to the gene of interest by ligase.
D) complementary to DNA sequences at both ends of the DNA sequence of interest.

Question 60

Which of the following is NOT involved in creating recombinant DNA?

A) restriction enzymes
B) ligase
C) RNA
D) plasmids

Question 61

In RNA ________,the expression of a specific gene is blocked by small pieces of RNA.

Question 62

Genetically modified organisms may contain proteins,DNA,and ________ from another organism.

Question 63

Genetically modified organisms are also called________ organisms.

Question 64

In the first step of the polymerase chain reaction (PCR),the two strands of the DNA being amplified must be separated by exposing the DNA to high ________.

Question 65

A DNA fingerprint is also called a DNA ________.

Question 66

Parkinson's disease,a devastating neurological disorder marked by uncontrollable body movements,may be treated with stem cell therapy and ________ medicine in the future.

Question 67

An enzyme that catalyzes the formation of covalent bonds between two DNA fragments,creating a single piece of DNA,is a(n)________.

Question 68

Pigs have been reproductively cloned whose organs will not stimulate the ________.

Question 69

During ________ cloning,the nucleus of an egg cell is replaced with the nucleus of a somatic cell from the individual being cloned.

Question 70

Stem cells that can generate all body cell types,including those in the birth sac,are described as ________.

Question 71

The FBI produces DNA fingerprints from 13 STRs using ________ based amplification.

Question 72

Genetic engineering is a process in which specific sequences of ________ are deliberately isolated,modified,and inserted into a host organism.

Question 73

Short tandem repeats are used to create DNA fingerprints because they are highly ________ regions of DNA.

Question 74

It is theoretically impossible for two individuals (other than identical twins)to have the same DNA fingerprint.

Question 75

Hind III and AluI are examples of ________ used to cut DNA at specific sites.

Question 76

DNA from one organism will not bond to DNA from another organism.

Question 77

Bacteria are the most common host cells for DNA cloning because they reproduce rapidly and create many copies of the recombinant plasmid.

Question 78

DNA ________ occurs when complementary single-stranded DNA molecules from two different sources undergo base pairing.

Question 79

DNA fingerprinting can prove guilt without fail.

Question 80

Giving rise to all the cell types that occur in the human body,________ stem cells are obtained from the inner cell mass of a blastocyst.