Deck 2: Protein Synthesis

Full screen (f)
exit full mode
Question
Which feature or characteristic is most critical for protein function or activity?

A)The number of amino acids
B)The sequence of amino acids
C)Deletion of all active exons
D)Transcription occurring after translation
Use Space or
up arrow
down arrow
to flip the card.
Question
Which statement about single nucleotide polymorphisms (SNPs)is true?

A)SNPs can change an exon sequence into an intron sequence.
B)SNPs can change an intron sequence into an exon sequence.
C)SNPs are generally responsible for frameshift mutations.
D)SNPs are generally responsible for point mutations.
Question
Which statement about the introns within one gene is correct?

A)These small pieces of DNA form microRNAs that regulate gene expression.
B)They are part of the desert DNA composing the noncoding regions.
C)When expressed,they induce post-translational modifications.
D)The introns of one gene may be the exons of another gene.
Question
Why are people who have poor DNA repair mechanisms at greater risk for cancer development?

A)Their cancers are usually resistant to chemotherapy.
B)Their somatic mutations are more likely to be permanent.
C)They have greater exposure to environmental carcinogens.
D)They have sustained a mutational event in all cells and tissues.
Question
Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA,in which large letters represent introns and small letters represent exons?
TTGCGaAccaGaCTtaaAAtTAAA

A)AUGGUUAUUA
B)ACGCTCGATTATTT
C)ACGCUCGAUUAUUU
D)AACGCUUGGUCUGAAUUUUAAUUU
Question
What is the expected result of a "nonsense" point mutation?

A)Total disruption of the gene reading frame,no production of protein
B)Replacement of one amino acid with another in the final gene product
C)Replacing an amino acid codon with a "stop" codon,resulting in a truncated protein product
D)No change in amino acid sequence and no change in the composition of the protein product
Question
A strand of recently transcribed messenger RNA contains the following components:
1)exon
2)intron
3)intron
4)exon
5)intron
Which sequence represents the mature messenger RNA?

A)1,4
B)2,3,5
C)2,3,4
D)1,2,3,4,5
Question
How does replacement of thymine with uracil in messenger RNA help in the process of protein synthesis?

A)Allowing messenger RNA to leave the nucleus
B)Ensuring only the "sense" strand of DNA is transcribed
C)Determining the placement of the "start" signal for translation
D)Promoting post-translational modification for conversion to an active protein
Question
How does an acquired mutation in a somatic cell gene leading to cancer development affect a person's ability to pass on a predisposition for that cancer type to his or her children?

A)The predisposition can only be passed on if the person with the somatic cell mutation is female.
B)There is no risk of passing on a cancer predisposition to one's children from a somatic cell mutation.
C)The risk for predisposition is dependent upon which tissue type experienced the somatic mutation.
D)Multiple somatic mutations are required for passing on a predisposition to cancer development.
Question
What makes a frameshift mutational event more serious than a point mutational event?

A)Frameshift mutations occur primarily in germline cells,and point mutations occur only in somatic cells.
B)Frameshift mutations result in the deletion or addition of whole chromosomes (aneuploidy),and point mutations are undetectable at the chromosome level.
C)The rate of frameshift mutations increases with aging because DNA repair mechanisms decline,whereas the rate of point mutations is unchanged with age.
D)When the mutations occur in expressed genes,frameshift mutations always result in disruption of the gene function,whereas a point mutation can be silent.
Question
What is the expected outcome when a person (twin A)experiences a large deletion of DNA in one of his noncoding region and his monozygotic twin (twin B)does not?

A)DNA identification of each twin will be more specific.
B)Only their somatic cells will remain identical at all loci.
C)Only their germline cells will remain identical at all loci.
D)They will now be dizygotic twins instead of monozygotic twins.
Question
What is the function of ribosomes (also known as ribosomal RNA)in protein synthesis?

A)Allows interpretation of the two strands of DNA to determine which is the "sense" strand and which is the "antisense" strand
B)Serves as the coordinator mechanism to allow proper reading of the mRNA and placement of the correct amino acid in the sequence by the tRNAs
C)Allows further processing of synthesized proteins (post-translational modification in order to ensure that the final product is physiologically active)
D)Serves as a transport molecule able to move a specific amino acid to the site of protein synthesis (peptide chain elongation)in the correct sequence
Question
What is the relationship among genes,DNA,and proteins?

A)DNA is composed of a series of amino acids that provide the directions for synthesizing proteins.
B)Protein is composed of DNA that is organized into specific gene sequences called amino acids.
C)A gene is a section of DNA that provides the directions for synthesizing a specific protein.
D)Proteins are the nitrogenous bases that form double strands of DNA in its helical shape.
Question
How does an "anticodon" participate in protein synthesis?

A)Splicing out the introns to form a functional and mature messenger RNA
B)Identifying which DNA strand is the "sense" strand to transcribe into RNA
C)Ensuring the appropriate tRNA places the correct amino acid into the protein
D)Interpreting the correct "stop" triplet or codon that signals for translation termination
Question
The protein glucagon contains 29 amino acids in its active linear form.What is the minimum number of bases present in the mature messenger RNA for this protein?

A)29
B)58
C)87
D)116
Question
Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis?

A)These enzymes prevent overexpression of critical proteins.
B)Without ribonucleases,messenger RNA could leave one cell type and lead to excessive protein synthesis in a different cell type.
C)When ribonucleases degrade RNA,the degradation products are recycled,making protein synthesis more energy efficient.
D)The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production.
Question
After a protein is synthesized during translation,what further process or processes is/are needed for it to be fully functional?

A)No further processing beyond the linear arrangement of amino acids is required.
B)Although minimal function can occur in the linear form,the protein is more active when it undergoes mitosis.
C)The protein first twists into a secondary structure and then "folds" into a specific tertiary structure for activation and function.
D)The initial protein produced is a "preprotein" that requires a series of depolarizations by electrical impulses for conversion to an active protein.
Question
What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis?

A)Transcription for DNA synthesis is rapidly followed by the process of translation.
B)Transcription for protein synthesis has "greater fidelity" than does transcription for DNA synthesis.
C)Transcription for protein synthesis occurs only in cells undergoing mitosis,and transcription for DNA synthesis occurs in both dividing and nondividing cells.
D)Transcription for DNA synthesis occurs with both the "sense" and the "antisense" strands,while transcription for protein synthesis occurs with only the "sense" strand.
Question
How does the process of polyadenylation affect protein synthesis?

A)Binding to the antisense DNA strand to prevent inappropriate transcription
B)Promoting attachment of ribosomes to the correct end of messenger RNA
C)Linking the exons into the mature messenger RNA
D)Signaling the termination of mRNA translation
Question
Which DNA segment deletion would cause a frameshift mutation?

A)TCT
B)GAGTC
C)TACTAC
D)GCATGACCC
Unlock Deck
Sign up to unlock the cards in this deck!
Unlock Deck
Unlock Deck
1/20
auto play flashcards
Play
simple tutorial
Full screen (f)
exit full mode
Deck 2: Protein Synthesis
1
Which feature or characteristic is most critical for protein function or activity?

A)The number of amino acids
B)The sequence of amino acids
C)Deletion of all active exons
D)Transcription occurring after translation
The sequence of amino acids
2
Which statement about single nucleotide polymorphisms (SNPs)is true?

A)SNPs can change an exon sequence into an intron sequence.
B)SNPs can change an intron sequence into an exon sequence.
C)SNPs are generally responsible for frameshift mutations.
D)SNPs are generally responsible for point mutations.
SNPs are generally responsible for point mutations.
3
Which statement about the introns within one gene is correct?

A)These small pieces of DNA form microRNAs that regulate gene expression.
B)They are part of the desert DNA composing the noncoding regions.
C)When expressed,they induce post-translational modifications.
D)The introns of one gene may be the exons of another gene.
The introns of one gene may be the exons of another gene.
4
Why are people who have poor DNA repair mechanisms at greater risk for cancer development?

A)Their cancers are usually resistant to chemotherapy.
B)Their somatic mutations are more likely to be permanent.
C)They have greater exposure to environmental carcinogens.
D)They have sustained a mutational event in all cells and tissues.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
5
Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA,in which large letters represent introns and small letters represent exons?
TTGCGaAccaGaCTtaaAAtTAAA

A)AUGGUUAUUA
B)ACGCTCGATTATTT
C)ACGCUCGAUUAUUU
D)AACGCUUGGUCUGAAUUUUAAUUU
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
6
What is the expected result of a "nonsense" point mutation?

A)Total disruption of the gene reading frame,no production of protein
B)Replacement of one amino acid with another in the final gene product
C)Replacing an amino acid codon with a "stop" codon,resulting in a truncated protein product
D)No change in amino acid sequence and no change in the composition of the protein product
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
7
A strand of recently transcribed messenger RNA contains the following components:
1)exon
2)intron
3)intron
4)exon
5)intron
Which sequence represents the mature messenger RNA?

A)1,4
B)2,3,5
C)2,3,4
D)1,2,3,4,5
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
8
How does replacement of thymine with uracil in messenger RNA help in the process of protein synthesis?

A)Allowing messenger RNA to leave the nucleus
B)Ensuring only the "sense" strand of DNA is transcribed
C)Determining the placement of the "start" signal for translation
D)Promoting post-translational modification for conversion to an active protein
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
9
How does an acquired mutation in a somatic cell gene leading to cancer development affect a person's ability to pass on a predisposition for that cancer type to his or her children?

A)The predisposition can only be passed on if the person with the somatic cell mutation is female.
B)There is no risk of passing on a cancer predisposition to one's children from a somatic cell mutation.
C)The risk for predisposition is dependent upon which tissue type experienced the somatic mutation.
D)Multiple somatic mutations are required for passing on a predisposition to cancer development.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
10
What makes a frameshift mutational event more serious than a point mutational event?

A)Frameshift mutations occur primarily in germline cells,and point mutations occur only in somatic cells.
B)Frameshift mutations result in the deletion or addition of whole chromosomes (aneuploidy),and point mutations are undetectable at the chromosome level.
C)The rate of frameshift mutations increases with aging because DNA repair mechanisms decline,whereas the rate of point mutations is unchanged with age.
D)When the mutations occur in expressed genes,frameshift mutations always result in disruption of the gene function,whereas a point mutation can be silent.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
11
What is the expected outcome when a person (twin A)experiences a large deletion of DNA in one of his noncoding region and his monozygotic twin (twin B)does not?

A)DNA identification of each twin will be more specific.
B)Only their somatic cells will remain identical at all loci.
C)Only their germline cells will remain identical at all loci.
D)They will now be dizygotic twins instead of monozygotic twins.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
12
What is the function of ribosomes (also known as ribosomal RNA)in protein synthesis?

A)Allows interpretation of the two strands of DNA to determine which is the "sense" strand and which is the "antisense" strand
B)Serves as the coordinator mechanism to allow proper reading of the mRNA and placement of the correct amino acid in the sequence by the tRNAs
C)Allows further processing of synthesized proteins (post-translational modification in order to ensure that the final product is physiologically active)
D)Serves as a transport molecule able to move a specific amino acid to the site of protein synthesis (peptide chain elongation)in the correct sequence
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
13
What is the relationship among genes,DNA,and proteins?

A)DNA is composed of a series of amino acids that provide the directions for synthesizing proteins.
B)Protein is composed of DNA that is organized into specific gene sequences called amino acids.
C)A gene is a section of DNA that provides the directions for synthesizing a specific protein.
D)Proteins are the nitrogenous bases that form double strands of DNA in its helical shape.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
14
How does an "anticodon" participate in protein synthesis?

A)Splicing out the introns to form a functional and mature messenger RNA
B)Identifying which DNA strand is the "sense" strand to transcribe into RNA
C)Ensuring the appropriate tRNA places the correct amino acid into the protein
D)Interpreting the correct "stop" triplet or codon that signals for translation termination
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
15
The protein glucagon contains 29 amino acids in its active linear form.What is the minimum number of bases present in the mature messenger RNA for this protein?

A)29
B)58
C)87
D)116
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
16
Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis?

A)These enzymes prevent overexpression of critical proteins.
B)Without ribonucleases,messenger RNA could leave one cell type and lead to excessive protein synthesis in a different cell type.
C)When ribonucleases degrade RNA,the degradation products are recycled,making protein synthesis more energy efficient.
D)The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
17
After a protein is synthesized during translation,what further process or processes is/are needed for it to be fully functional?

A)No further processing beyond the linear arrangement of amino acids is required.
B)Although minimal function can occur in the linear form,the protein is more active when it undergoes mitosis.
C)The protein first twists into a secondary structure and then "folds" into a specific tertiary structure for activation and function.
D)The initial protein produced is a "preprotein" that requires a series of depolarizations by electrical impulses for conversion to an active protein.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
18
What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis?

A)Transcription for DNA synthesis is rapidly followed by the process of translation.
B)Transcription for protein synthesis has "greater fidelity" than does transcription for DNA synthesis.
C)Transcription for protein synthesis occurs only in cells undergoing mitosis,and transcription for DNA synthesis occurs in both dividing and nondividing cells.
D)Transcription for DNA synthesis occurs with both the "sense" and the "antisense" strands,while transcription for protein synthesis occurs with only the "sense" strand.
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
19
How does the process of polyadenylation affect protein synthesis?

A)Binding to the antisense DNA strand to prevent inappropriate transcription
B)Promoting attachment of ribosomes to the correct end of messenger RNA
C)Linking the exons into the mature messenger RNA
D)Signaling the termination of mRNA translation
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
20
Which DNA segment deletion would cause a frameshift mutation?

A)TCT
B)GAGTC
C)TACTAC
D)GCATGACCC
Unlock Deck
Unlock for access to all 20 flashcards in this deck.
Unlock Deck
k this deck
locked card icon
Unlock Deck
Unlock for access to all 20 flashcards in this deck.