Deck 12: DNA Technology and Genomics

Question 1

When plasmids are used to produce a desired protein

A) the plasmids are inserted into the bacterial chromosome.
B) the plasmids multiply and produce the protein outside of the bacterium.
C) the desired gene is inserted into the plasmid, and the plasmid is returned to the bacterium by transformation.
D) the bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene (often the cell of a plant or animal).

Answer 1

C

Question 2

DNA ligase binds

A) recombinant DNA to transformed bacterial cells.
B) recombinant DNA to recombinant proteins.
C) nucleotides in the DNA backbone together.
D) nucleotide base pairs from opposite strands together.

Answer 2

C

Question 3

Which of the following statements about nucleic acid probes is false?

A) A nucleic acid probe is a double-stranded DNA molecule.
B) A nucleic acid probe can be used to find a specific gene.
C) A nucleic acid probe binds to a complementary sequence in the gene of interest.
D) A nucleic acid probe is usually labeled with a radioactive isotope or fluorescent tag to help identify its location.

Answer 3

A

Question 4

________ are a major source of restriction enzymes.

A) Plant cells
B) Human cells
C) Bacteria

Question 5

The advantage of being able to clone the gene for human insulin is that

A) there are too few cows, pigs, and horses to provide an adequate supply of their insulin.
B) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin.
C) cow, pig, or horse insulin cannot keep a diabetic alive for more than 3 months.
D) using human insulin increases the probability that, in the future, the person suffering from diabetes can be weaned from a dependence on insulin.

Question 6

"Sticky ends" are

A) produced by the action of DNA ligase.
B) another name for the 5' cap on mRNA transcripts.
C) always long sequences of a single nucleotide.
D) DNA fragments with single-stranded ends.

Question 7

Restriction enzymes

A) facilitate nucleotide base pairing.
B) cut DNA at specific sites.
C) stop transcription and translation.
D) bind together strands of DNA.

Question 8

The only cells that can correctly attach sugars to proteins to form glycoprotein products are

A) yeast cells.
B) E. coli cells.
C) mammalian cells.
D) algal cells.

Question 9

The enzyme that converts information stored in RNA to information stored in DNA is

A) DNA ligase.
B) reverse transcriptase.
C) a restriction enzyme.
D) RNA polymerase.

Question 10

Biotechnology

A) is a modern scientific discipline that has existed for only a few decades.
B) is strictly concerned with the manipulation of DNA.
C) has been around since the dawn of civilization.
D) is generally considered more harmful than valuable to society.

Question 11

A nucleic acid probe is a(n)

A) virus that transfers DNA to a recipient cell.
B) piece of radioactively labeled DNA that is used to locate a specific gene.
C) enzyme that locates a specific restriction site on RNA.
D) plasmid that recognizes a specific DNA sequence.

Question 12

The production of multiple identical copies of a target sequence of DNA defines

A) gene cloning.
B) DNA cloning.
C) DNA technology.
D) genetic engineering.

Question 13

The ________ approach to gene cloning employs a mixture of fragments from the entire genome of an organism and results in the production of thousands of different recombinant plasmids.

A) shotgun
B) genetic engineering
C) restriction
D) cloning

Question 14

The feature of "sticky ends" that makes them especially useful in DNA recombination is their ability to

A) bind to DNA and thereby activate transcription.
B) bind to ribosomes and thereby activate translation.
C) form hydrogen-bonded base pairs with complementary single-stranded stretches of DNA.
D) allow plasmids to attach to the main bacterial chromosome.

Question 15

Restriction enzymes specifically recognize and cut short sequences of DNA called

A) introns.
B) exons.
C) sticky ends.
D) restriction sites.

Question 16

A vaccine works by

A) inhibiting bacterial replication.
B) stimulating the immune system.
C) inhibiting viral replication.
D) preventing the translation of mRNA.

Question 17

An advantage of using reverse transcriptase to prepare a gene for cloning is that

A) reverse transcriptase is more efficient than RNA polymerase.
B) the resulting DNA strand will lack exons.
C) reverse transcriptase is more efficient than DNA polymerase.
D) the resulting DNA strand will lack introns.

Question 18

In the process of human gene cloning using plasmids, the bacterial plasmid is

A) used as the vector.
B) the source of the gene to be cloned.
C) cultured inside the human cell, which contains the gene to be cloned.
D) used to insert the human gene into the bacterial chromosome.

Question 19

When DNA from two sources is combined into one single piece of DNA, it is known as

A) cloned DNA.
B) recombinant DNA.
C) a vector.
D) a plasmid.

Question 20

After DNA fragments with matching sticky ends are temporarily joined by complementary base pairing, the union can be made permanent by the "pasting" enzyme

A) DNA ligase.
B) DNA polymerase.
C) Cas9.
D) reverse transcriptase.

Question 21

Which genetically modified organism has not been developed by genetic engineers (at least, not yet)?

A) transgenic rice with genes for milk proteins
B) transgenic salmon with a growth hormone gene that allows them to grow more quickly
C) transgenic corn with the gene for human insulin
D) transgenic pigs with a roundworm gene that allows them to make more omega-3 fatty acids

Question 22

If you commit a crime, you need to make sure that you do not leave even the smallest speck of blood, hair, or other organic matter from your body. If you do, the DNA in this material can be amplified by ________, subjected to genetic analysis, and used to identify you as the perpetrator of the crime.

A) PCR
B) STR analysis
C) restriction digests

Question 23

Which pieces of evidence would be considered the best for establishing biological relatedness?

A) birth certificates
B) pictures from family reunions
C) testimony from relatives
D) a very close match in the DNA profile

Question 24

What is the current standard tool used for DNA profiling by forensic scientists?

A) STR analysis
B) gene cloning
C) genetic engineering
D) CRISPR

Question 25

Gel electrophoresis sorts DNA molecules on the basis of their

A) nucleotide sequence.
B) ability to bind to mRNA.
C) solubility in the gel.
D) size.

Question 26

What is the preferred name of the technique used to determine if DNA comes from a particular individual?

A) DNA technology
B) DNA profiling
C) DNA microarrays

Question 27

Golden Rice is golden in color because it is rich in

A) vitamin A.
B) vitamin C.
C) beta-carotene.

Question 28

A transgenic animal is an animal

A) that is the first of its kind to bear a particular allele.
B) in which a genetic defect has been corrected using recombinant DNA therapy.
C) containing a gene from another organism, typically of another species.
D) containing genes from three or more species.

Question 29

Approximately what percentage of human DNA does not code for proteins?

A) 49%
B) 79%
C) 98.5%
D) 99.9%

Question 30

Which statement about genomics is false?

A) The first complete genome to be sequenced was a prokaryote.
B) Whole sets of genes and their interactions are studied in the field of genomics.
C) Genes from different species that have analogous sequences suggest similar function.
D) DNA technology limits genomic studies to prokaryotes.

Question 31

Which of the following statements about DNA technology is false?

A) DNA technology is now used to mass-produce human insulin.
B) DNA technology is now used to mass-produce human growth hormone.
C) DNA technology is now used to create cells that can identify and kill cancer cells.
D) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen.

Question 32

Which \statement about genome sequencing is false?

A) The genomes of thousands of species have been completely sequenced.
B) The first eukaryotic organism to have its genome sequenced was yeast.
C) Most of the genomes that have been sequenced to date are eukaryotes.
D) The genome of a mouse has been sequenced.

Question 33

Which issue has not been significant in the creation of genetically modified (GM) organisms?

A) some plants carrying genes from other species representing a possible threat to the environment
B) inability of GM organisms to be modified to prevent them from reproducing once they pass beyond the experimental stage
C) the fact that rogue microbes might transfer dangerous genes into other organisms
D) the fact that the protein products of transplanted genes might lead to allergic reactions

Question 34

During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.

A) sample mixture
B) positively charged electrode
C) negatively charged electrode
D) agarose gel

Question 35

Genetically modifying ________ cells may directly affect future generations.

A) bone marrow
B) somatic
C) gamete-forming
D) skin

Question 36

In order for gene therapy to be permanent in the patient being treated,

A) the defective gene must first be removed from all somatic cells.
B) the normal gene must be added to the germ-line cells.
C) the normal gene must first be treated with UV radiation to ensure noninfectivity.
D) the normal gene must be transferred to somatic cells that can continuously multiply.

Question 37

The type of repetitive DNA composed of sequences of large repeated units is often associated with

A) tandem repeats.
B) transposable elements.
C) sex-linked genes.
D) transcription factors.

Question 38

Segments of eukaryotic DNA that can move or be copied from one site to another in the genome are called

A) exons.
B) plasmids.
C) transposable elements.
D) vectors.

Question 39

Which of the following statements regarding repetitive DNA is false?

A) Repetitive DNA is usually found between genes.
B) Repetitive DNA is identical in all humans.
C) Repetitive DNA is usually repeated multiple times in the genome.
D) Repetitive DNA can show great variation among individuals.

Question 40

The polymerase chain reaction relies upon unusual, heat-resistant ________ that were isolated from bacteria living in hot springs.

A) DNA polymerases
B) DNA ligases
C) restriction enzymes
D) plasmids

Question 41

The number of proteins in humans

A) is approximately equal to the number of genes.
B) is less than half the number of genes.
C) is much greater than the number of genes.

Question 42

Which is a genetically modified organism but not a transgenic organism?

A) Flavr Savr peaches (peaches that express larger quantities of a peach stability enzyme)
B) Golden Rice (rice that expresses daffodil and bacteria beta-carotene synthesis enzymes)
C) AquAdvantage salmon (Atlantic salmon that expresses Chinook salmon growth hormone)
D) Roundup Ready soybeans (soybeans that express bacterial pesticide enzymes)

Question 43

Which is a transgenic organism?

A) a fern grown from a single fern root cell
B) a rat that has had rabbit hemoglobin genes added to its genome
C) a cow that has been fed pig growth hormone in its food
D) a human given a corrected human blood-clotting gene

Question 44

Which statement regarding proteomics is true?

A) Proteomics is the study of protein interaction within a cell.
B) Proteomics involves the complete analysis of prokaryote DNA.
C) Proteomics is the systematic study of the full set of proteins encoded by a genome.

Question 45

Some restriction enzymes do not leave sticky ends when cutting DNA molecules; rather, they cut a restriction site down the middle and leave "blunt-ended" DNA molecules, which do not have any single-stranded nucleotide extensions. Which of the following is not a likely outcome when trying to insert a gene into a plasmid when both have been cut with the same "blunt-ended" restriction enzyme?

A) The gene might be inserted into the plasmid by forming hydrogen bonds.
B) The gene might be inserted into the plasmid multiple times in a row.
C) The gene might insert into the plasmid in the proper (forward) orientation.
D) The gene might insert into the plasmid in the wrong (backward) orientation.

Question 46

TPOX is one of the STRs that is used to compare DNA between different people. Why is TPOX useful for comparing DNA between different people?

A) TPOX varies in the number of repeats between different people.
B) TPOX varies in sequence between different people.
C) TPOX is only present in some people's genomes.
D) TPOX is present in different places in different people's genomes.

Question 47

You are trying to produce cDNA starting from mRNA in skeletal muscle cells. You add the following components to a tube and let the reaction proceed: skeletal muscle mRNA, free nucleotides, and DNA polymerase. After inspecting the products of the reaction, you do not find any cDNA molecules at all. What is the most likely explanation for this result?

A) You used mRNA instead of genomic DNA as the source material.
B) You used DNA polymerase instead of reverse transcriptase.
C) cDNA can only be made from skin cell mRNA molecules.
D) You forgot to add a radiolabeled nucleic acid probe to the tube.

Question 48

Researchers are trying to make a genetically modified (GM) pig that expresses bovine (cow) growth hormone to make it grow bigger. They isolated the bovine growth hormone gene, cut it and a plasmid with the same restriction enzyme, and mixed them together. They inserted the mixture into pig zygotes, but only normal pigs, not GM pigs, grew. What did they likely do wrong?

A) They are trying to make a GM animal, which is impossible.
B) They forgot to add DNA ligase after mixing the plasmid and gene together.
C) They should have used different restriction enzymes to cut the plasmid and the gene.
D) They forgot to use PCR and make multiple copies of the growth hormone gene.

Question 49

The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?

A) two
B) three
C) four
D) five

Question 50

Cystic fibrosis is a genetic disease that results from a defective CFTR protein that alters ion flow through the cell membrane such that water does not cross the cell membrane. Gene therapy is being used to attempt to help cystic fibrosis patients. Which of the following steps is not needed to develop a gene therapy treatment for cystic fibrosis?

A) Clone the normal-functioning CFTR gene and make an RNA version of the gene.
B) Make antibodies to the defective CFTR protein to enhance the patient's immune system.
C) Remove cells from a patient and infect them with the recombinant virus.
D) Insert the RNA version of the CFTR gene into a virus.

Question 51

When cloning a gene, one of the steps is to use restriction enzymes to insert the gene of interest into a vector. If you separated the empty vector (the vector without the gene of interest) and the cloned vector (the vector that has the gene of interest added) using agarose gel electrophoresis, what do you expect to observe on the agarose gel if both vectors are loaded at the same position at the top of the gel?

A) The empty vector would migrate farther down than the cloned vector.
B) The cloned vector would migrate farther down than the cloned vector.
C) The empty vector would migrate the same distance as the cloned vector.

Question 52

You are setting up a PCR reaction and add a primer for one end of the target sequence, but you forget to add the primer for the other end of the target sequence. If you added the other necessary components, what do you expect to observe after running the PCR reaction for 40 cycles?

A) The PCR reaction will produce billions of copies of the target DNA.
B) The PCR reaction will produce millions of copies of the target DNA.
C) The PCR reaction will produce one copy of the target DNA.
D) The PCR reaction will produce zero copies of the target DNA.

Question 53

A researcher can use BLAST for all of the following except

A) to compare gene sequences between species.
B) to compare DNA sequences within a species.
C) to compare nucleotide sequences within a species.
D) to compare carbohydrate compositions between species.

Question 54

Genome sequence analysis suggests that Neanderthals

A) never interbred with humans.
B) are more closely related to chimpanzees than humans.
C) were lactose intolerant as adults.
D) could not speak.

Question 55

Approximately what percentage of the human genome is identical to that of a chimpanzee?

A) 50.0%
B) 62.3%
C) 92.0%
D) 98.8%

Question 56

Which statement regarding the human genome is false?

A) Long stretches of repetitive DNA are prominent at centromeres and ends of chromosomes.
B) The human genome is smaller than that of the bacterium Haemophilus influenzae.
C) Current estimates are that there are about 21,000 genes in the human genome.
D) The human genome contains approximately 19% introns.

Question 57

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

A) two
B) three
C) four
D) five

Question 58

Gel electrophoresis is normally set up with the negative electrode at the top of the gel and the positive electrode at the bottom of the gel. The DNA products are loaded at the top of the gel, and then a current is applied to separate them. However, when preparing to run a gel, you accidentally switched the locations of the negative and positive electrodes such that the positive electrode is at the top and the negative electrode is at the bottom. You still loaded the DNA products at the top of the gel as normal. What result are you most likely to observe if you apply an electric current to this gel setup?

A) All DNA molecules will migrate toward the positive electrode.
B) All DNA molecules will migrate toward the negative electrode.
C) Shorter DNA molecules will toward the positive electrode, and longer DNA molecules will move toward the negative electrode.
D) Longer DNA molecules will move toward the positive electrode, and shorter DNA molecules will move toward the negative electrode.

Question 59

Biotechnology companies sell kits that allow you to do PCR to amplify STR regions from human blood samples that you have collected. What components would you expect to find in the kit in order to be able to do successful PCR reactions?

A) human DNA polymerase, primers that flank STR regions only
B) heat-stable DNA polymerase, primers that flank STR regions only
C) human DNA polymerase, primers that flank STR regions, free nucleotides
D) heat-stable DNA polymerase, primers that flank STR regions, free nucleotides

Question 60

Why is the whole-genome shotgun method currently the tool of choice for analyzing genomes?

A) It is extremely accurate.
B) Multiple genomes can be analyzed simultaneously.
C) It is fast and inexpensive.

Question 61

After reading the paragraphs below, answer the questions that follow.
Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing, frequent lung infections, and ultimately death.
Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death).
If you wanted to produce a recombinant form of DNase I, what cell type should you use?

A) E. coli
B) yeast
C) mammalian
D) plant

Question 62

Suppose a researcher is interested in using the CRISPR-Cas9 system to knock out the phosphofructokinase gene of a rat skin cell that codes for an enzyme that is critical for glycolysis to occur. The researcher added the Cas9 enzyme to the cell but forgot to add the guide RNA. What result do you think the researcher will observe?

A) Glycolysis will proceed normally in the cell.
B) The phosphofructokinase enzyme will be expressed but will have lower activity.
C) Cas9 will specifically cut the phosphofructokinase gene.
D) There will be mutations in the phosphofructokinase gene.

Question 63

After reading the paragraphs below, answer the questions that follow.
Researchers are using the CRISPR-Cas9 system to genetically engineer organisms in order to study gene function and to attempt to help patients with genetic diseases. In 2016, a research team used the CRISPR-Cas9 system to genetically alter pig zygotes so that they would have muscular dystrophy, a type of genetic disease that results in muscle wasting and loss of muscle mass. This disease often results from a lack of the protein dystrophin in skeletal muscle tissue. Researchers sometimes develop animal models of diseases so that they can develop therapies to treat the human version of the disease.
The researchers compared the molecular biology and physiology of two types of pigs: healthy, normal pigs (WT) and those that were modified when they were zygotes with the CRISPR-Cas9 system (CRISPR). The data below show the dystrophin levels in various tissues from both types of pigs.
Source: Adapted from Yu, H. H., Zhao, H., Qing, Y. B., Pan, W. R., Jia, B. Y., Zhao, H. Y., Huang, X. X., et al. (2016). Porcine zygote injection with Cas9/sgRNA results in DMD-modified pig with muscle dystrophy. International Journal of Molecular Sciences,17(10): 1668. MDPI AG. Retrieved from http://dx.doi.org/10.3390/ijms17101668.
In this study, what would have been true of the guide RNA that was used in the CRISPR-Cas9 system?

A) The guide RNA was complementary in sequence to a region of the dystrophin gene.
B) The guide RNA was injected into skeletal muscle cells, heart cells, and intestinal cells.
C) The guide RNA helped target the Cas9 enzyme to the dystrophin protein.

Question 64

After reading the paragraph below, answer the questions that follow.
Four decades after the end of the Vietnam War, the remains of an Air Force pilot were discovered and returned to the United States. A search of Air Force records identified three families to which the remains might possibly belong. Each family had a surviving twin of a missing service member. The following STR profiles were obtained from the remains of the pilot and the surviving twins from the three families.

Based on analysis of the STR sites shown, does the missing pilot belong to any of these three families?

A) No, none of the families match.
B) Yes, family 1 matches.
C) Yes, family 2 matches.
D) Yes, family 3 matches.

Question 65

What can you conclude from this figure?

A) Nematodes have more genes that mustard plants.
B) The size of the genome is negatively correlated with the number of genes.
C) Mammals tend to have the largest genomes.
D) Animals have the largest numbers of genes.

Question 66

Use the accompanying figure to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. CS, crime scene; S1, suspect 1; S2, suspect 2; S3, suspect 3. Which suspect is likely to have committed the crime?

A) suspect 1
B) suspect 2
C) suspect 3

Question 67

What sequence is indicated by the data between the brackets?

A) GAGTG
B) GGAGTGG
C) GGAAGGTTGG
D) GAAGGTTG

Question 68

Use the accompanying figure to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. Approximately how many bases are in the DNA molecule that the arrow is pointing to?

A) 30 bases
B) 36 bases
C) 40 bases
D) 44 bases

Question 69

What type of cell is the Cas9 enzyme naturally found in?

A) plant
B) animal
C) prokaryote
D) fungi

Question 70

After reading the paragraph below, answer the questions that follow.
Four decades after the end of the Vietnam War, the remains of an Air Force pilot were discovered and returned to the United States. A search of Air Force records identified three families to which the remains might possibly belong. Each family had a surviving twin of a missing service member. The following STR profiles were obtained from the remains of the pilot and the surviving twins from the three families.

In order to match the pilot's remains to the correct family using DNA profiling,

A) the majority of the STR bands must match.
B) each of the 13 STR bands must match.
C) the bands for site 13 must match.
D) bands 5 and 7 must match.

Question 71

After reading the paragraphs below, answer the questions that follow.
Researchers are using the CRISPR-Cas9 system to genetically engineer organisms in order to study gene function and to attempt to help patients with genetic diseases. In 2016, a research team used the CRISPR-Cas9 system to genetically alter pig zygotes so that they would have muscular dystrophy, a type of genetic disease that results in muscle wasting and loss of muscle mass. This disease often results from a lack of the protein dystrophin in skeletal muscle tissue. Researchers sometimes develop animal models of diseases so that they can develop therapies to treat the human version of the disease.
The researchers compared the molecular biology and physiology of two types of pigs: healthy, normal pigs (WT) and those that were modified when they were zygotes with the CRISPR-Cas9 system (CRISPR). The data below show the dystrophin levels in various tissues from both types of pigs.
Source: Adapted from Yu, H. H., Zhao, H., Qing, Y. B., Pan, W. R., Jia, B. Y., Zhao, H. Y., Huang, X. X., et al. (2016). Porcine zygote injection with Cas9/sgRNA results in DMD-modified pig with muscle dystrophy. International Journal of Molecular Sciences,17(10): 1668. MDPI AG. Retrieved from http://dx.doi.org/10.3390/ijms17101668.
What can you conclude from the figure?

A) The CRISPR-Cas9 system was mostly successful in specifically targeting the dystrophin gene only in skeletal muscle cells.
B) The dystrophin protein is not expressed in heart cells.
C) The WT pigs had a higher level of dystrophin mRNA in their intestinal cells when compared to the CRISPR pigs.
D) Cas9 acted to hydrolyze the dystrophin protein in all three tissues of the CRISPR pigs.

Question 72

Which step in this process requires use of restriction enzymes?

A) step A
B) step B
C) step C
D) step D

Question 73

After reading the paragraph below, answer the questions that follow.
Four decades after the end of the Vietnam War, the remains of an Air Force pilot were discovered and returned to the United States. A search of Air Force records identified three families to which the remains might possibly belong. Each family had a surviving twin of a missing service member. The following STR profiles were obtained from the remains of the pilot and the surviving twins from the three families.

Based on analysis of the STR sites shown, which family is the missing pilot least likely to belong to?

A) family 1
B) family 2
C) family 3
D) Family 1 and family 2 are equally unlikely.

Question 74

Which technology is possible to achieve using next-generation or third-generation sequencing?

A) sequencing 2 trillion nucleotides in a day
B) sequencing the entire human genome for less than $100
C) sequencing DNA by moving a strand through a pore

Question 75

After reading the paragraphs below, answer the questions that follow.
Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing, frequent lung infections, and ultimately death.
Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death).
If recombinant DNase I is added to a vial of respiratory secretions from a cystic fibrosis patient, which of the following results would indicate that the recombinant DNase I is functional?

A) The secretions become thicker and more viscous.
B) The secretions become less viscous.
C) There is no effect on the secretions.

Question 76

After reading the paragraphs below, answer the questions that follow.
Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing, frequent lung infections, and ultimately death.
Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death).
A scientist produced a batch of recombinant DNase I in E. coli cells and a batch in mammalian cells. She placed 0.1 mg of the E. coli-derived DNase I in a vial containing a solution of DNA, and she placed 0.1 mg of the mammalian cell-derived DNase I in a separate vial containing the same solution of DNA. The initial viscosity of the DNA solutions was identical. What do you expect the viscosity of the DNA solutions to be after 10 minutes have passed, and why?

A) The viscosity of the mammalian cell DNase I vial will be lower than that of the E. coli DNase I vial because the mammalian cell DNase I will be functional and able to degrade the DNA.
B) The viscosity of the mammalian cell DNase I vial will be higher than that of the E. coli DNase I vial because the mammalian cell DNase I will be functional and able to degrade the DNA.
C) The viscosity of the E. coli DNase I vial will be lower than that of the mammalian cell DNase I vial because the E. coli DNase I will be functional and able to degrade the DNA.
D) The viscosity of the E. coli DNase I vial will be higher than that of the mammalian cell DNase I vial because the E. coli DNase I will be functional and able to degrade the DNA.

Question 77

Why is a guide RNA needed when using CRISPR-Cas9 for gene editing?

A) to help Cas9 find the target DNA to cut
B) to help Cas9 be transported into the nucleus
C) to help repair the target DNA after it is cut
D) to help make copies of the target DNA

Question 78

What is the function of the Cas9 enzyme?

A) to cut RNA molecules
B) to cut DNA molecules
C) to hydrolyze proteins
D) to transport DNA into cells

Question 79

What other enzyme is the Cas9 enzyme most similar to?

A) DNA polymerase
B) DNA ligase
C) a restriction enzyme
D) reverse transcriptase

Question 80

Which step in the creation of cDNA involves the use of reverse transcriptase?

A) step 1
B) step 2
C) step 3
D) step 4