Deck 8: Nucleotides and Nucleic Acids

Question 1

A major component of RNA but not of DNA is:

A) adenine.
B) cytosine.
C) guanine.
D) thymine.
E) uracil.

Answer 1

E

Question 2

The alkaline hydrolysis of RNA does NOT produce:

A) 2'- AMP.
B) 2',3'-cGMP.
C) 2'-CMP.
D) 3',5'-cAMP.
E) 3'-UMP.

Answer 2

D

Question 3

The difference between thymine and uracil is:

A) one methylene group on the pyrimidine ring.
B) one methyl group on the pyrimidine ring.
C) one hydroxyl group on the ribose ring.
D) one amine group on the pyrimidine ring.
E) one methyl group on the purine ring.

Answer 3

B

Question 4

Based on Chargaff's rules, which base compositions for double-stranded DNA are possible? %A
%G
%C
%T
%U

A) 5
45
45
5
0
B) 20
20
20
20
20
C) 35
15
35
15
0
D) All of the answers are correct.
E) None of the answers is correct.

Question 5

Chargaff's rules state that in typical DNA:

A) A = G.
B) A = C.
C) A = U.
D) A + T = G + C.
E) A + G = T + C.

Question 6

The difference between a ribonucleotide and a deoxyribonucleotide is:

A) a deoxyribonucleotide has an -H instead of an -OH at C-2.
B) a deoxyribonucleotide has an -H instead of an -OH at C-3.
C) a ribonucleotide has an extra -OH at C-4.
D) a ribonucleotide has more structural flexibility than deoxyribonucleotide.
E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose.

Question 7

In a double-stranded nucleic acid, cytosine typically base-pairs with:

A) adenosine.
B) guanine.
C) inosine.
D) thymine.
E) uracil.

Question 8

The nucleic acid bases:

A) absorb ultraviolet light maximally at 280 nm.
B) are all about the same size.
C) are relatively hydrophilic.
D) are roughly planar.
E) can all stably base-pair with one another.

Question 9

Which statement concerning the tautomeric forms of bases such as uracil is CORRECT?

A) The double-lactim form contains a ketone group.
B) The lactam form contains an alcohol group.
C) The lactam form predominates at neutral pH.
D) Formation of the lactim from the lactam is irreversible.
E) The lactim and double-lactim forms are stabilized at high pH.

Question 10

In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which property?

A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.
B) The molecular weights of the two base pairs are identical.
C) The number of hydrogen bonds formed between the two bases of the base pair is the same.
D) The plane of neither base pair is perpendicular to the axis of the helix.
E) The proton-binding groups in both base pairs are in their charged or ionized form.

Question 11

The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that:

A) bacteria can undergo transformation.
B) genes are composed of DNA only.
C) mice are more susceptible to pneumonia than are humans.
D) pneumonia can be cured by transformation.
E) virulence is determine genetically.

Question 12

The phosphodiester bond that joins adjacent nucleotides in DNA:

A) associates ionically with metal ions, polyamines, and proteins.
B) is positively charged.
C) is susceptible to alkaline hydrolysis.
D) Links C-2 of one base to C-3 of the next.
E) links C-3 of deoxyribose to N-1 of thymine or cytosine.

Question 13

In the Watson-Crick structure of DNA, the:

A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis.
B) adenine content of one strand must equal the thymine content of the same strand.
C) nucleotides are arranged in the A-form.
D) purine content (fraction of bases that are purines) must be the same in both strands.
E) two strands are parallel.

Question 14

The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is:

A) a deoxyribonucleoside.
B) a purine nucleotide.
C) a pyrimidine nucleotide.
D) adenosine monophosphate.
E) adenosine.

Question 15

Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens.

A) 1; 1; 1; 1
B) 1; 2; 1; 2
C) 2; 1; 1; 2
D) 2; 2; 1; 1
E) 2; 2; 1; 2

Question 16

In the Watson-Crick model for the DNA double helix, which statement is NOT true?

A) The two strands run anti-parallel to one another.
B) The base-pairing occurs on the inside of the double helix.
C) The double helix is right-handed.
D) There are two equally sized grooves that run up the sides of the helix.
E) The two strands have complementary sequences.

Question 17

Which statement is TRUE of the pentoses found in nucleic acids?

A) C-5 and C-1 of the pentose are joined to phosphate groups.
B) The pentoses are in a planar configuration.
C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond.
D) The pentoses are always in the $\beta$ -furanose forms.
E) The straight-chain and ring forms undergo constant interconversion.

Question 18

For the oligoribonucleotide pACGUAC, the nucleotide at the:

A) 3' end has a phosphate at its 3' hydroxyl.
B) 3' end is a purine.
C) 5' end has a 5' hydroxyl.
D) 5' end has a phosphate on its 5' hydroxyl.
E) 5' end is a pyrimidine.

Question 19

The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA:

A) always link A with T and G with C.
B) are susceptible to alkaline hydrolysis.
C) are uncharged at neutral pH.
D) form between the planar rings of adjacent bases.
E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next.

Question 20

The DNA oligonucleotide abbreviated pATCGAC:

A) has seven phosphate groups.
B) has a hydroxyl at its 3' end.
C) has a phosphate on its 3' end.
D) has an A at its 3' end.
E) violates Chargaff's rules.

Question 21

When double-stranded DNA is heated at neutral pH, which change does NOT occur?

A) The absorption of ultraviolet (260 nm) light increases.
B) The covalent N-glycosidic bond between the base and the pentose breaks.
C) The helical structure unwinds.
D) The hydrogen bonds between A and T break.
E) The viscosity of the solution decreases.

Question 22

Which base compositions for single-stranded RNA are possible? %A
%G
%C
%T
%U

A) 5
45
45
0
5
B) 25
25
25
0
25
C) 35
10
30
0
25
D) All of the answers are correct.
E) None of the answers is correct.

Question 23

In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is/are:

A) heat.
B) low pH.
C) oxygen.
D) UV light.
E) both oxygen and UV light.

Question 24

Which deoxyoligonucleotide will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')?

A) (5')CTCATTGAG(3')
B) (5')GACCAGTCT(3')
C) (5')GAGTCAACT(3')
D) (5')TCTGACCAG(3')
E) (5')TCTGGATCT(3')

Question 25

Which statement is NOT true of all naturally occurring DNA?

A) Deoxyribose units are connected by 3',5'-phosphodiester bonds.
B) The amount of A always equals the amount of T.
C) The ratio A+T/G+C is constant for all natural DNAs.
D) The two complementary strands are antiparallel.
E) Two hydrogen bonds form between A and T.

Question 26

In DNA sequencing by the Sanger (dideoxy) method:

A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands.
B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis.
C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence.
D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands.
E) the template DNA strand is radioactive.

Question 27

In the chemical synthesis of DNA:

A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond.
B) the direction of synthesis is 5' to 3'.
C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides.
D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product.
E) the protecting cyanoethyl groups are removed after each step.

Question 28

In the Watson-Crick model of DNA structure:

A) both strands run in the same direction, 3' $\rightarrow$ 5'; they are parallel.
B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water.
C) T can form three hydrogen bonds with either G or C in the opposite strand.
D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines.
E) the distance between two adjacent bases in one strand is about 3.4 Å.

Question 29

The double helix of DNA in the B-form is stabilized by:

A) covalent bonds between the 3' end of one strand and the 5' end of the other.
B) hydrogen bonding between the phosphate groups of two side-by-side strands.
C) hydrogen bonds between the riboses of each strand.
D) nonspecific base-stacking interaction between two adjacent bases in the same strand.
E) ribose interactions with the planar base pairs.

Question 30

Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily:

A) covalent bonds involving deoxyribose.
B) covalent bonds involving the bases.
C) hydrogen bonds involving deoxyribose.
D) hydrogen bonds involving the bases.
E) hydrophobic interactions involving the bases.

Question 31

Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by:

A) breakage of phosphodiester bonds.
B) deamination of bases.
C) depurination.
D) formation of thymine dimers.
E) transformation of A $\rightarrow$ T.

Question 32

Which sequence is palindromic?

A) AGGTCC
TCCAGG
B) CCTTCC
GCAAGG
C) GAATCC
CTTAGG
D) GGATCC
CCTAGG
E) GTATCC
CATAGG

Question 33

In nucleotides and nucleic acids, syn and anti conformations relate to:

A) base stereoisomers.
B) rotation around the phosphodiester bond.
C) rotation around the sugar-base bond.
D) sugar pucker.
E) sugar stereoisomers.

Question 34

In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is:

A) DNA-DNA > DNA-RNA > RNA-RNA.
B) DNA-DNA > RNA-RNA > DNA-RNA.
C) RNA-DNA > RNA-RNA > DNA-DNA.
D) RNA-RNA > DNA-DNA > DNA-RNA.
E) RNA-RNA > DNA-RNA > DNA-DNA.

Question 35

Double-stranded regions of RNA:

A) are less stable than double-stranded regions of DNA.
B) can be observed in the laboratory, but probably have no biological relevance.
C) can form between two self-complementary regions of the same single strand of RNA.
D) do not occur.
E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).

Question 36

B-form DNA in vivo is a _____-handed helix, _____ Å in diameter, with a rise of _____ Å per base pair.

A) left; 20; 3.9
B) right; 18; 3.4
C) right; 18; 3.6
D) right; 20; 3.4
E) right; 23; 2.6

Question 37

Double stranded regions of RNA typically take on a(n):

A) A-form left-handed helix.
B) A-form right-handed helix.
C) B-form left-handed helix.
D) B-form right-handed helix.
E) Z-form left-handed helix.

Question 38

The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with:

A) (5')CACTAGTTCG(3').
B) (5')CACUAGUUCG(3').
C) (5')CACUTTCGCCC(3').
D) (5')GCTTGATCAC(3').
E) (5')GCCTAGTTUG(3').

Question 39

In the Watson-Crick model of DNA structure (now called B-form DNA):

A) a purine in one strand always hydrogen bonds with a purine in the other strand.
B) A-T pairs share three hydrogen bonds.
C) G-C pairs share two hydrogen bonds.
D) the 5' ends of both strands are at one end of the helix.
E) the bases occupy the interior of the helix.

Question 40

For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to:

A) base-pairing interactions via H-bonds.
B) interactions along the phosphate backbone.
C) base-stacking interactions via van-der-Waals interactions.
D) covalent bonds between adjacent bases in one strand.
E) ionic interactions with metal ions.

Question 41

Double-stranded DNA was isolated from a cryophilic bacterium. Which choice is MOST likely to represent a possible composition of its bases?

A) 30% A:T, 70% G:C
B) 50% A:T, 50% G:C
C) 70% A:T, 30% G:C
D) Any of these choices is a likely composition.
E) None of these choices is a likely composition.

Question 42

A pyrimidine is joined covalently to the pentose sugar through the:

A) N-1 of the base to the 1' carbon of the pentose.
B) N-9 of the base to the 1' carbon of the pentose.
C) N-1 of the base to the 5' carbon of the pentose.
D) N-9 of the base to the 5' carbon of the pentose.
E) None of the answers is correct.

Question 43

Which statement is NOT true about base stacking when nucleic acids are in a double-stranded conformation?

A) Stacking interactions occur when two or more bases are positioned with their rings parallel to each other.
B) Stacking interactions are hydrophilic in nature.
C) Stacking involves a combination of van der Waals and dipole-dipole interactions between bases.
D) Base stacking helps to minimize contact of the bases with water.
E) Base stacking interactions are important in stabilizing the three-dimensional structure of nucleic acids.

Question 44

Hoogsteen base-pairing occurs when a third strand of DNA binds along the _____ of a double helix of DNA.

A) minor groove
B) major groove
C) free 5'end
D) free 3'end
E) Any of these parts of a DNA double helix could participate in a Hoogsteen interaction.

Question 45

The MOST striking difference between A-, B-, and Z-form DNA is that:

A) A -orm does not contain a major and minor groove.
B) B-form has the smallest helical diameter.
C) Z-form is left handed.
D) B-form has the greatest number of base pairs per helical turn.
E) A-form maximizes base stacking interactions.

Question 46

The CORRECT name for the molecule shown below is:

A) 5-methylcytidine.
B) C⁵-methylcytidine.
C) 5-methyluridine.
D) C⁵-methylthymidine.
E) 5-methylthymidine.

Question 47

Which conformation is NOT permitted due to steric interference?

A) purine in syn conformation
B) purine in anti conformation
C) pyrimidine in syn conformation
D) pyrimidine in anti conformation
E) All of these conformations are permitted.

Question 48

The covalent backbone of DNA and RNA consists of:

A) alternating phosphate groups and nitrogenous bases.
B) alternating phosphate groups and pentose residues.
C) alternating pentose residues and nitrogenous bases.
D) alternating pentose residues and cyclic nucleosides.
E) None of the answers is correct.

Question 49

The chemical difference between a nucleotide and a nucleoside is that:

A) a different nitrogenous base is added to each.
B) nucleotides do not contain phosphate groups.
C) nucleosides do not contain phosphate groups.
D) nucleotides do not contain pentose sugars
E) nucleosides do not contain pentose sugars.

Question 50

The structures seen below would MOST likely be formed by:

A) W: RNA / X: RNA / Y: DNA
B) W: RNA / X: DNA / Y: DNA
C) W: DNA / X: DNA / Y: RNA
D) W: DNA / X: RNA / Y: RNA
E) W: RNA / X: RNA / Y: RNA

Question 51

What is the MOST likely length of an mRNA that will code for a polypeptide with 150 amino acids?

A) 50 nucleotides
B) 150 nucleotides
C) 450 nucleotides
D) >450 nucleotides
E) All of these lengths are possible depending on the organism in which the mRNA is found.

Question 52

In living cells, nucleotides and their derivatives can serve as:

A) carriers of metabolic energy.
B) enzyme cofactors.
C) intracellular signals.
D) precursors for nucleic acid synthesis.
E) All of the answers are correct.

Question 53

A tetraplex of DNA is MOST likely to form with which residue?

A) Adenosine
B) Thymidine
C) Guanosine
D) Cytidine
E) A tetraplex is equally likely with all bases.

Question 54

In a nucleoside, the pentose sugar is in its _____ form, and the ring is _____.

A) $\alpha$ -furanose; planar
B) $\alpha$ -pyranose; puckered
C) $\beta$ -furanose; planar
D) $\beta$ -furanose; puckered
E) $\beta$ -pyranose; planar

Question 55

DNA is _____ chemically stable than RNA due to the _____ on _____.

A) more; 2'-hydroxyl groups; RNA
B) more; 2'-hydroxyl groups; DNA
C) more; 3'-hydroxyl groups; RNA
D) less; 2'-hydroxyl groups; RNA
E) less; 2'-hydroxyl groups; DNA

Question 56

The 5' $\rightarrow$ 3' orientation of a DNA or RNA chain refers to the:

A) linkage of the phosphodiester bonds between the nucleotides.
B) location of the attachment of the nitrogenous base on the pentose sugar.
C) positions of the chain that do not have a nucleotide attached.
D) positions of the chain that do not have a phosphate group attached.
E) respective net charges found at each end of the chain.

Question 57

Which single-stranded nucleic acid could form a hairpin structure?

A) 5' TTTGCGATACTCATCGCATT 3'
B) 5'TTTGCGATACTCACGCTATT 3'
C) 5' TTTGCGATACTCTGCGATTT 3'
D) All of the answers are correct.
E) None of the answers is correct.

Question 58

The "energy carrier" ATP is an example of a(n):

A) deoxyribonucleoside triphosphate.
B) dinucleotide.
C) peptide.
D) ribonucleotide.
E) ribonucleoside triphosphate.

Question 59

The chemical moiety of nucleotides that allows quantification of concentration via UV absorbance is the:

A) phosphate group(s).
B) pentose sugar.
C) nitrogenous base.
D) hydroxyl group(s) on the pentose sugar.
E) None of the answers is correct.

Question 60

The scientists who used x-ray crystallography to shed light on the three-dimensional structure of DNA were:

A) Erwin Chargaff and colleagues.
B) Alfred D. Hershey and Martha Chase.
C) James Watson and Francis Crick.
D) Rosalind Franklin and Maurice Wilkins.
E) Oswald T. Avery, Colin MacLeod, and Maclyn McCarty.

Question 61

When performing PCR, what is the advantage to using a DNA polymerase isolated from a thermophilic organism?

A) The PCR reaction does not need to be cooled below the denaturation step.
B) The PCR reaction does not need primers to proceed.
C) The PCR reaction does not need to have fresh enzyme added after each cycle.
D) The PCR reaction does not need to have fresh dNTPs added after each cycle.
E) The PCR reaction does not need to have fresh template DNA added after each cycle.

Question 62

Which type of damage to DNA structure is MOST likely to be caused by UV light?

A) deamination
B) pyrimidine dimers
C) depurination
D) depyrimidination
E) hydrolysis of the phosphodiester bond

Question 63

According to the sequence below (note that the DNA is written in the 5' $\rightarrow$ 3' direction, and the gene of interest is underlined), the BEST forward primer to use for this gene is:

A) 5' GGTTTGAATCAAATGGCTGA 3'.
B) 5'ATGACTGATACATCATCCTC 3'.
C) 3' ATGACTGATACATCATCCTC 5'.
D) 5' GAGGATGATGTATCAGTCAT 3'.
E) 3' GAGGATGATGTATCAGTCAT 5'.

Question 64

The image below shows a DNA sequencing gel using the Sanger method. The top of the gel is the anode and the bottom is the cathode. What is the sequence of the template DNA?

A) 5' ACTAGTGACCGT 3'
B) 5'TGCCAGTGATCA 3'
C) 5' ACGGTCACTAGT 3'
D) 5' TGATCACTGGCA 3'
E) It cannot be determined from this information.

Question 65

The image below shows a Sanger DNA sequencing gel where one ingredient was left out of all sequencing reactions. The top of the gel is the anode and the bottom of the gel is the cathode. The gel was turned on and ran correctly. What is the MOST likely missing ingredient?

A) dNTPs
B) ddNTPs
C) radioactive DNA primer
D) DNA polymerase
E) template DNA

Question 66

One of the MOST common regulatory second messengers in cells is:

A) FAD.
B) NAD⁺.
C) coenzyme A.
D) ATP.
E) cAMP.

Question 67

Which of the following would have the HIGHEST melting temperature?

A) 20-mer double-stranded DNA-DNA duplex
B) 20-mer double-stranded RNA-RNA duplex
C) 40-mer double-stranded DNA-DNA duplex
D) 40-mer double-stranded DNA-RNA duplex
E) 40-mer double-stranded RNA-RNA duplex

Question 68

Briefly describe the experimental evidence of Avery, MacLeod, and McCarty that DNA is the genetic material.

Question 69

The image below shows a DNA sequencing gel using the Sanger method. The top of the gel is the anode and the bottom is the cathode. Which band represents the shortest and longest fragments of DNA?

A) shortest = Z, longest = W
B) shortest = X, longest = Z
C) shortest = W, longest = Y
D) shortest = Y, longest = X
E) shortest = W, longest = Z

Question 70

How are a nucleoside and a nucleotide similar and how are they different?

Question 71

Which statement describes a function of the addition of methyl groups to DNA?

A) Methylation is used by E. coli as part of a defense mechanism to distinguish its DNA from foreign DNA.
B) Methylation serves as a marker during repair of DNA during replication.
C) Methylation of DNA occurs in some animals when infected with certain bacteriophages.
D) All of the statements describe a function of DNA methylation.
E) None of the statements describes a function of DNA methylation.

Question 72

Which DNA primer would have the HIGHEST melting temperature?

A) GCATCGGC
B) AATCGGAT
C) ATACAGATCGGC
D) ACCGGCAGGTCGGC
E) ATACGCAGATCGGC

Question 73

Compounds that contain a nitrogenous base, a sugar, and a phosphate group are called (a) _____.
Two purines found in DNA are (b) _____ and _____
A pyrimidine found in all DNA but in only some RNA is (c) _____.
In DNA, the base pair (d) _____-_____ is held together by three hydrogen bonds;
the base pair (e) _____-_____ has only two such bonds.

Question 74

Incubation of DNA at low pH is MOST likely to cause:

A) depurination.
B) depyrimidination.
C) mutation of cytosine to uracil.
D) hydrolysis of the phosphodiester bond.
E) deamination of adenine and guanine.

Question 75

What would happen if blocking tags were NOT used in reversible terminator sequencing, a next-generation method of DNA sequencing?

A) The DNA fragments to sequence/read would be too large.
B) More than one dNTP could be incorporated to the same growing nucleotide chain during a single cycle.
C) The flow cell could not immobilize DNA fragments.
D) Multiple fluorescent colors could be observed across the flow cell at the same time.
E) Luciferase would not react in the presence of ATP.

Question 76

How did the addition of different-colored fluorescent tags on each ddNTP improve the Sanger DNA sequencing method?

A) Scientists did not need to use a heat-stable DNA polymerase.
B) A DNA primer was no longer needed.
C) All four ddNTPs could be incorporated into a single reaction.
D) Scientists could now use short tandem repeats to assist their sequencing.
E) The template DNA could now be double stranded.

Question 77

Match the type of bond with the role below:
Bond type
Role
(a) phosphodiester
___ links base to pentose in nucleotide
(b) N-glycosidic
___ joins adjacent nucleotides in one strand
(c) phosphate ester
___ joins complementary nucleotides in two strands
(d) hydrogen
___ difference between a nucleoside and a nucleotide

Question 78

A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the addition of nucleotides is detected by a:

A) radioactive signal.
B) fluorescently labeled dNTP.
C) pulse from a laser.
D) flash of light.
E) nano-ruler's physical movement of 4.54 nm detected by laser.

Question 79

Which molecule contains the GREATEST amount of stored chemical energy?

A) dGTP
B) GDP
C) dGDP
D) GMP
E) cGMP

Question 80

According to the sequence below (note that the DNA is written in the 5' $\rightarrow$ 3' direction, and the gene of interest is underlined), the BEST reverse primer to use for this gene is:

A) 5' ATTGAATCCTTGGCT GGTGA 3'.
B) ' ATTGAATCCTTGGCT GGTGA 5'.
C) 5' TCACCAGCCAAGGATTCAAT 3'.
D) 3' TCACCAGCCAAGGATTCAAT 5''.
E) 3' GGTGAGTCGG TTCAATTCGT 5'.