Chat with AI
Biochemistry 4th Edition by Reginald Garrett, Charles Grisham
Edition 4ISBN: 9780495109358Biochemistry 4th Edition by Reginald Garrett, Charles Grisham
Edition 4ISBN: 9780495109358 Exercise 6
Designing primers for PCR amplification of a DNA sequence
Given the following short DNA duplex of sequence (5' * 3')
ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCACACATGCACACACATGACATAGGACAGATAGCAT
what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex
Given the following short DNA duplex of sequence (5' * 3')
ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCACACATGCACACACATGACATAGGACAGATAGCAT
what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex
Explanation
Verified
Verified
If enough information regarding the desi...
Biochemistry 4th Edition by Reginald Garrett, Charles Grisham
Why don’t you like this exercise?
Other Minimum 8 character and maximum 255 character
Character 255
