expand icon
book Biochemistry 4th Edition by Christopher Mathews,Kensal van Holde, Dean Appling, Spencer Anthony Cahill cover

Biochemistry 4th Edition by Christopher Mathews,Kensal van Holde, Dean Appling, Spencer Anthony Cahill

Edition 4ISBN: 978-0138004644
book Biochemistry 4th Edition by Christopher Mathews,Kensal van Holde, Dean Appling, Spencer Anthony Cahill cover

Biochemistry 4th Edition by Christopher Mathews,Kensal van Holde, Dean Appling, Spencer Anthony Cahill

Edition 4ISBN: 978-0138004644
Exercise 11
Note that some of these problems refer to information presented in the Tools of Biochemistry 5A-D.
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for.
5 GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3
Explanation
Verified
like image
like image

The nucleotides in DNA (Deoxyribose nucl...

close menu
Biochemistry 4th Edition by Christopher Mathews,Kensal van Holde, Dean Appling, Spencer Anthony Cahill
cross icon