Molecular Biology 5th Edition by Robert Weaver

Exercise 1

Here is the sequence of a portion of a bacterial gene:
5GTATCGTATGCATGCATCGTGAC3
3CATAGCATACGTACGTAGCACTG5
The template strand is on the bottom. (a) Assuming that transcription starts with the first T in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment (b) Find the initiation codon in this mRNA. (c) Would there be an effect on translation of changing the first G in the template strand to a C If so, what effect (d) Would there be an effect on translation of changing the second T in the template strand to a G If so, what effect (e) Would there be an effect on translation of changing the last T in the template strand to a C If so, what effect (Hint: You do not need to know the genetic code to answer these questions; you just need to know the nature of initiation and termination codons given in this chapter.)