Solved

Referring to the Given Image, What Is the Amino Acid

Question 77

Multiple Choice

    Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA? A)  asp-gly-val-glu-glu-trp-tyr B)  leu-pro-glu-leu-leu-thr-ile C)  ile-thr-leu-leu-gly-pro-leu D)  ser-arg-arg-met-gly-val-stop E)  met-gly-val-lys-ser-gly-stop  
Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?


A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions