Deck 15: DNA Technology

Question 1

Genetic engineering works because all organisms

A) contain plasmids.
B) can contract the same diseases.
C) share the same chemical DNA structure.
D) contain the same genes.

Answer 1

C

Question 2

The most efficient method of determining the base sequence of a piece of DNA is to

A) insert the ligase gene.
B) expose it to radioactivity.
C) use an automated sequencing machine.
D) hand-count the base pairs.

Answer 2

C

Question 3

Cloning is useful because it

A) repairs broken DNA.
B) mixes the DNA from two different organisms.
C) produces many copies of a gene.
D) determines the base sequence of a gene.

Answer 3

C

Question 4

The genes for the normal and sickle cell anemia alleles of hemoglobin are cut with the restriction enzyme DdeI. The resulting DNA fragments were separated by gel electrophoresis, producing the gel shown in the figure below.
Why are the patterns produced by these two alleles different?

A) The normal hemoglobin gene is cut by two restriction enzymes, but the sickle cell anemia allele is cut by only one restriction enzyme.
B) The gene for the normal allele is much larger than the gene for sickle cell anemia.
C) The gene for the normal allele has a sequence recognized by DdeI, but the gene for sickle cell anemia does not.
D) The sickle cell allele has the ability to produce ligase to repair the damage done by restriction enzymes, but the normal allele does not.

Question 5

A segment of DNA in a test tube replicates and produces many copies of itself. What was probably in the test tube that enhanced this process?

A) a ligase
B) a restriction enzyme
C) DNA polymerase
D) an electric current

Question 6

DNA extraction

A) uses restriction enzymes to prevent chromosomes from unraveling.
B) can only occur when the gene of interested has be amplified by PCR.
C) occurs only in prokaryotic cells since they lack a protective nucleus.
D) requires that all non-DNA organic compounds be removed with chemicals.

Question 7

You are shown the following result of gel electrophoresis in the figure below.
Column 1 represents blood found on the arm of a crime victim, but is not the victim's blood. The other columns are blood taken from various suspects. Which suspect is most likely the guilty one?

A) 2
B) 3
C) 4
D) 5

Question 8

After electrophoresis has been performed, the stripes in one lane of a gel are

A) different-sized DNA molecules.
B) the digested restriction enzyme.
C) RNA from different cells.
D) DNA hybridization sites.

Question 9

Gel electrophoresis uses

A) an electrical current.
B) ligases.
C) DNA polymerase.
D) viral vectors.

Question 10

The polymerase chain reaction (PCR) is used to

A) produce many copies of a selected DNA sequence.
B) insert DNA from one organism into a new host.
C) screen for a particular gene.
D) deliver DNA products into a human patient.

Question 11

Among these DNA fragments which would move most quickly during gel electrophoresis?

A) AATAAT
B) AATAATAATAAT
C) AAATTAAT
D) AATAATAATAATAATAATAAT

Question 12

A vector is used to

A) transfer a fragment of DNA from one species to another.
B) separate DNA fragments from one another.
C) probe DNA for faulty genes.
D) attach DNA fragments to one another.

Question 13

In nature, the function of a restriction enzyme is to

A) connect DNA fragments after replication.
B) protect bacteria from invading foreign DNA.
C) speed up the rate at which bacteria can metabolize their energy sources.
D) make numerous copies of a given gene.

Question 14

Cloning and sequencing are important in the study of inherited diseases, because

A) many copies of the gene can be ligated.
B) the protein product that produces the disease can be determined.
C) the process can be reversed to cure the disease.
D) the clones can be easily paired.

Question 15

Gel electrophoresis is used to

A) connect two DNA fragments to each other.
B) snip DNA into smaller molecules.
C) separate DNA molecules by size.
D) determine the exact base sequence of a DNA molecule.

Question 16

A sample of the same DNA is placed into each of two test tubes. Each tube is treated with a restriction enzyme and the resulting fragments are separated by gel electrophoresis producing the gel shown in the figure below.
Which of the following explains why the pattern of DNA fragments differs in these two samples?

A) Different restriction enzymes must have been used in the different tubes.
B) One tube was heated, but the other tube was not.
C) Ligase was added to one of the tubes, but not the other.
D) The restriction enzyme added to the tubes cut DNA at more than one sequence.

Question 17

A restriction enzyme cuts DNA into fragments

A) whenever the correct ligase is present.
B) only in laboratory conditions.
C) only in the organism that produces it.
D) when mixed with the DNA that contains the target DNA sequence.

Question 18

To make recombinant DNA,

A) two nonhomologous chromosomes are induced to undergo crossing-over during meiosis.
B) the entire genome of one organism is fused to a plasmid.
C) pieces of DNA from different organisms are cut with restriction enzymes and then glued together with ligase.
D) DNA polymerase is used to make multiple copies of the DNA sequences of two organisms at the same time.

Question 19

Ligases are used to

A) connect two DNA fragments to each other.
B) snip DNA into smaller molecules.
C) separate DNA molecules by size.
D) determine the exact base sequence of a DNA molecule.

Question 20

A restriction enzyme from a bacterium is able to cut a human's DNA because

A) bacteria and humans are both prokaryotes.
B) all organisms use the same DNA bases.
C) bacteria and humans have identical genomes.
D) a given restriction enzyme can cut DNA at several different sequences.

Question 21

In research, restriction enzymes are used to

A) stop replication of DNA at a specific base during DNA sequencing.
B) cut DNA molecules into pieces that can be used to create recombinant DNA.
C) measure the relative amounts of each base in a DNA molecule.
D) join two fragments of DNA together to form a molecule of recombinant DNA.

Question 22

In RFLP analysis, which regions of DNA would provide the strongest evidence of a genetic relationship?

A) regions with noncoding and spacer DNA
B) regions that contain the genes for hemoglobin
C) regions that might contain genes related to personality disorders
D) regions that can be easily fragmented

Question 23

Deliberately transferring a gene from one species to another is an example of

A) constructing a gene library.
B) genetic engineering.
C) the polymerase chain reaction.
D) cloning.

Question 24

The primers used in PCR are

A) identical to the entire base sequence of one strand of the DNA.
B) produced when a gene of interest is read by restriction enzymes.
C) attached to the gene of interest by ligase.
D) complementary to DNA sequences at both ends of the gene of interest.

Question 25

Many different fragments of DNA from an oak tree genome are inserted into a plasmid vector, which is then taken up by bacteria that copy the inserted DNA every time they reproduce. This procedure is known as

A) DNA probing.
B) DNA fingerprinting.
C) the polymerase chain reaction (PCR).
D) the construction of a DNA library.

Question 26

DNA _______ is the set of techniques with which scientists manipulate DNA.

Question 27

DNA identification of individuals is possible because

A) the same restriction enzyme cuts different individuals' DNA in different places.
B) a different restriction enzyme is needed to cut each person's DNA.
C) a different species of bacteria is needed for the DNA library of each person.
D) each person's DNA uses a different set of bases.

Question 28

Human gene therapy involves

A) correcting genetic disorders by modifying the genes that cause them.
B) using plasmids to carry genes that will break down a specific harmful gene in a patient.
C) inserting genes from other organisms into the human genome.
D) using PCR to produce large amounts of normal DNA that can be injected into a patient.

Question 29

To screen a colony of bacteria for a particular gene you would

A) use gel electrophoresis.
B) use a ligase.
C) use a probe.
D) use a restriction enzyme.

Question 30

The use of DNA analysis to identify individuals is known as

A) PCR testing.
B) DNA fingerprinting.
C) genetic modification.
D) cloning.

Question 31

The poplar, a type of tree, does not produce flowers until it is eight years old. How does this characteristic make the poplar a good candidate for genetic engineering?

A) The slow growth rate of poplars makes it easier for every cell of a tree to be genetically modified with a gene gun.
B) Plants reject recombinant DNA when they start reproducing. The longer than normal maturation time of poplars extends the usefulness of the plant in processes like bioremdiation.
C) Plants do not begin producing the gene products of recombinant DNA until after they mature and begin reproducing. The shorter than normal maturation time of poplars allows them to become useful faster.
D) It is easy to prevent poplars from spreading recombinant DNA to wild tree populations since you can cut them down before they start reproducing.

Question 32

Which of the following is not an example of humans changing the DNA of an organism?

A) treating a patient with a medication that cures an infection
B) adding a disease-resistant gene to a crop plant
C) dog breeding
D) gene therapy

Question 33

A detective finds a miniscule spot of blood on a murder suspect's shirt. What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

A) inserting the blood's DNA into viral DNA
B) polymerase chain reaction (PCR)
C) inserting the sample's DNA into a plasmid
D) using ligases to bond the DNA fragments together for sequencing.

Question 34

The goal of DNA __________ is to make many copies of a piece of recombinant DNA so that the DNA can be further manipulated and studied.

Question 35

The immune disorder adenosine deaminase (ADA) deficiency, is the result of a mutation in one gene. How could gene therapy be used to treat this disorder?

A) Red blood cells could be induced to produce the protein encoded by the mutated ADA gene.
B) Cells containing a corrected ADA gene could be injected into patients with ADA.
C) Synthetic blood cells could be swallowed by the patients.
D) Patients could be injected with a hybrid molecule made of the DNA and RNA of the normal ADA gene.

Question 36

If you knew the sequence of a gene in one organism, how could you determine if another organism had a similar gene?

A) treat the genomes of both organisms with the same restriction enzyme and compare the patterns of the bands produced with gel electrophoresis
B) insert the known gene into a vector and use the vector to insert the known gene into the other organism
C) create labeled DNA probes from the known gene and use them to screen the DNA library of the other organism
D) create a hybrid of the two organisms by breeding them and check for mutations

Question 37

Which of the following DNA fragments would bind to the short probe, AAG?

A) ATACCAGGC
B) AAATGTATG
C) AAATTCATG
D) TTAGGTTTG

Question 38

The figure below shows the first cycle in a polymerase chain reaction (PCR).
What is the role of the structure marked "P" in this figure?

A) The "P" represents the heat-tolerant DNA polymerase used in PCR to copy the gene of interest.
B) The "P" represents a sequence of DNA complementary to parts of the gene being amplified that allows DNA polymerase to attach to the gene.
C) The "P" indicates where on the DNA that DNA polymerase should terminate replication.
D) The "P" indicates the location of the promoter for the gene being amplified.

Question 39

The polymerase chain reaction (PCR) technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes?

A) Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary.
B) Bacterial enzymes can only move through the gel during PCR electrophoresis.
C) DNA can only be cut into fragments at high temperatures.
D) The temperature required to separate DNA strands during PCR degrades most normal enzymes.

Question 40

DNA polymerase is used in the laboratory to

A) perform gel electrophoresis procedures.
B) cure patients of certain genetic diseases.
C) make many copies of a DNA sequence.
D) attach DNA fragments to each other.

Question 41

DNA _______ is the base pairing of DNA from two different sources.

Question 42

Genetic engineering works only on animals and has not yet been successfully used on plants.

Question 43

RFLP analysis is one method used to perform DNA fingerprinting.

Question 44

Human gene _______ seeks to correct genetic disorders by fixing the genes that cause the disorders.

Question 45

HindIII and AluI are examples of _______ _______ used to cut DNA at specific sites.

Question 46

In the first step of the polymerase chain reaction (PCR), the two strands of the DNA being amplified must be separated by exposing the DNA to high _______.

Question 47

Genetic engineering has been used to mass-produce insulin for diabetics.

Question 48

Genetic engineering is a process in which specific sequences of DNA _______ are deliberately isolated, modified, and inserted back into a host organism.

Question 49

DNA from one organism will not bond to DNA from another organism.

Question 50

A DNA _______ is a collection of one organism's DNA fragments that are stored in another organism.

Question 51

Because the ____________ regions of DNA show the highest level of variation between individuals, they are most commonly analyzed during DNA fingerprinting.

Question 52

Growing a new house plant from a cutting taken from another plant is an example of whole organism cloning.

Question 53

During _______________ cloning, the nucleus of an egg cell is replaced with the nucleus of a somatic cell from the individual being cloned.

Question 54

A _______ is a small, circular portion of DNA that is found in bacteria and is not part of the main genome.

Question 55

There are no risks associated with DNA technology.

Question 56

_______ catalyzes the formation of covalent bonds between two DNA fragments, creating a single piece of DNA.

Question 57

A DNA _______ that binds to a certain sequence can be used to test for the presence of an allele or gene.

Question 58

DNA moves toward the __________ charged end of an electrical field during gel electrophoresis.

Question 59

The polymerase chain reaction (PCR) uses a _______ that can pair to the target DNA to give DNA polymerase a starting point.

Question 60

Restriction enzymes work only on bacterial DNA.

Question 61

DNA fingerprinting can prove guilt without fail.

Question 62

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

Question 63

It is theoretically impossible for two individuals (other than identical twins) to have the same DNA fingerprint

Question 64

Genetically modified plants can pass their recombinant DNA to wild plants of the same species through their pollen