Deck 12: Genomes

Question 1

Which statement about the Human Genome Project (HGP)is false?

A) The sequencing of smaller genomes helped in the development of methods that benefited the HGP.
B) Only privately funded groups were involved in the sequencing effort.
C) The HGP was in part spurred on by a desire to determine the specific DNA damage caused by radiation from the atomic blasts on Japan during World War II.
D) One objective of the HGP was to identify genetic changes associated with disease.
E) It was completed in the first decade of the twenty-first century.

Answer 1

B

Question 2

DNA sequencing resembles the natural process of

A) protein synthesis.
B) DNA repair.
C) DNA replication.
D) reverse transcription.
E) alternative splicing.

Answer 2

C

Question 3

What is the major difference between the DNA sequencing techniques developed by Sanger and others in the 1970s and high-throughput sequencing methods?

A) High-throughput sequencing enables the direct sequencing of a chromosome from one end to the next.
B) Unlike the earlier technology,high-throughput sequencing involves cutting the DNA into fragments.
C) Unlike the earlier technology,high-throughput sequencing relies heavily on miniaturization techniques.
D) High-throughput sequencing involves chemical modification of nucleotides,whereas the earlier technology does not.
E) Unlike the earlier technology,high-throughput sequencing does not use PCR.

Answer 3

C

Question 4

Which statement about dogs and dog genomes is false?

A) Dogs vary tremendously in size and shape because they were domesticated from many different,and different looking,species of wolves.
B) Most of the genes of dogs have close counterparts to genes in humans.
C) Many of the diseases of dogs have close counterparts to diseases in humans.
D) Genetic markers can be used to determine the location of genes that influence traits in dogs.
E) The molecular methods used to analyze dogs have been applied to many other animals.

Question 5

In high-throughput DNA sequencing technology,the PCR technique

A) breaks the DNA into small fragments.
B) produces many identical copies of specific DNA fragments.
C) labels each of the four nucleotides with a different marker.
D) enables overlapping sequences to be assembled into one complete sequence.
E) chemically modifies each nucleotide.

Question 6

In high-throughput DNA sequencing,the universal adapter sequence is _______ to the universal _______ sequence.

A) identical;primer
B) identical;polymerase
C) identical;template
D) complementary;primer
E) complementary;polymerase

Question 7

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

A) functional genomics.
B) comparative genomics.
C) metagenomics.
D) biodiversity.
E) proteomics.

Question 8

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3'): CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3'): CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

A) CGACGTCGTCGCCCGATACGTTATCG
B) GTCGTCGCCCGATACGTTATCGCGAC
C) CGATACGTTATCGCGACGTCGTCGCC
D) CGATACGTCGTCGCCGTTATCGCGAC
E) CGAUACGUCGUCGCCGUUAUCGCGAC

Question 9

A DNA sequence has been cut into the three overlapping sequence fragments below: (1)CCGCGCGTAGCGAGTCAG
(2)GGCTAGTTAGCTCCGCGCG
(3)AGTCAGTCAAAAT
What is the correct assembled sequence of these fragments?

A) GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT
B) CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT
C) CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG
D) AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC
E) AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA

Question 10

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?

A) GTCATTGCTTGCAATGTT
B) TTGTAACGTTCGTTACTG
C) CAGTAACGAACGTTACAA
D) CCTGAATTGGTCGTACAA
E) GUCAUUGCUUGCAAUGUU

Question 11

Which DNA sequence would be the most difficult to assemble?

A) A sequence with an ORF
B) A sequence consisting of several short repeated fragments
C) A sequence with roughly equal proportions of As,Cs,Gs,and Ts
D) A sequence with a promoter
E) A sequence that contains the fragment CAGCTATT

Question 12

Which statement would be considered an expression of genetic determinism?

A) The proteome is more complex than the genome.
B) All people who are homozygous for the sickle-cell allele have sickle-cell disease.
C) Studying genes provides a limited understanding of what is going on in the cell.
D) The metabolome exerts considerable influence on the likelihood that an individual will develop diabetes.
E) High levels of glucose may be an indicator of coronary heart disease.

Question 13

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of

A) comparative genomics.
B) functional genomics.
C) pharmacogenomics.
D) metabolomics.
E) proteomics.

Question 14

A biologist is using computer programs and mathematical tools to assemble a large sequence of DNA from the data provided by multiple parallel runs of high-throughput sequencing.The term that best describes this biologist's field of study is

A) functional genomics.
B) comparative genomics.
C) metagenomics.
D) biodiversity.
E) bioinformatics.

Question 15

A promoter is an example of a(n)

A) open reading frame.
B) transposable element.
C) chromatin sequence.
D) rRNA gene.
E) regulatory sequence.

Question 16

A sequence contains an open reading frame that begins with a start codon.Most likely,it

A) contains highly repetitive DNA.
B) contains moderately repetitive DNA.
C) codes for a protein.
D) is in a centromeric region.
E) is in a teleomeric region.

Question 17

In high-throughput DNA sequencing technology,the fluorescent dye

A) breaks the DNA into fragments.
B) produces many identical copies of specific DNA fragments.
C) labels each of the four nucleotides with a different marker.
D) enables overlapping sequences to be assembled into one complete sequence.
E) chemically modifies each nucleotide.

Question 18

A biologist sequencing the DNA of various species of pathogenic bacteria with the goal of determining their evolutionary relationships is practicing _______ genomics.

A) functional
B) operational
C) meta-
D) comparative
E) eukaryotic

Question 19

Which statement about the human proteome is false?

A) It is the sum total of all proteins produced by an organism.
B) It is more complex than the genome.
C) It includes the small molecules found in a cell.
D) Its study often involves the use of two-dimensional gel electrophoresis.
E) All of the above are true;none is false.

Question 20

A DNA sequence has been cut into the four overlapping sequence fragments below: (1)AGGGGCCTATAGCATACGTACA
(2)CGTACATCTGAGGGTACGATCATGGC
(3)CATGGCTAGCAAACGCGATCCCAAG
(4)AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?

A) 1;2;3;4
B) 1;3;2;4
C) 2;3;1;4
D) 4;1;2;3
E) 4;1;3;2

Question 21

Two-dimensional gel electrophoresis separates proteins based on _______ and _______.

A) size;concentration
B) size;shape
C) size;charge
D) concentration;shape
E) shape;charge

Question 22

Which statement about eukaryotic genomes as compared with prokaryotic genomes is false?

A) They tend to be larger.
B) They tend to have more regulatory sequences.
C) The percentage of the genome devoted to coding sequence is higher.
D) They usually have more repetitive DNA.
E) They usually have more protein-coding genes.

Question 23

In which field would a scientist most likely use mass spectrometry?

A) Comparative genomics
B) Functional genomics
C) Metagenomics
D) Proteomics
E) Spectomics

Question 24

Which statement about Mycoplasma genitalium is false?

A) It lacks many genes common in other bacteria that are needed to synthesize amino acids.
B) It obtains many types of amino acids from the human urogenital tract.
C) It has a wide array of regulatory genes,many of which other bacteria lack.
D) Its genome is much smaller than that of E.coli.
E) It has limited biochemical flexibility.

Question 25

Studies find that a bacterium of the genus Buchnera has been living as a parasite of aphids for many millions of years.This bacterium lacks certain genes that are involved in the production of the cell wall found in other related bacteria.The field of biology in which such studies were carried out is called

A) metagenomics.
B) eukaryotic genomics.
C) proteomics.
D) comparative genomics.
E) haplotype mapping.

Question 26

Rank the following in terms of their relationship to the phenotypic characteristics of a cell or organism (from closest to most distant): the genome,the proteome,and the metabolome.

A) Genome;proteome;metabolome
B) Genome;metabolome;proteome
C) Proteome;metabolome;genome
D) Proteome;genome;metabolome
E) Metabolome;proteome;genome

Question 27

Which technique or activity is least likely to be associated with metagenomics?

A) Bacterial culture techniques
B) DNA sequencing
C) Comparative genomics
D) PCR
E) Sampling from the field

Question 28

The first free-living organism to have its complete genome sequenced was

A) the bacterium Haemophilus influenzae.
B) the bacterium Mycoplasma genitalium.
C) the fruit fly Drosophila melanogaster.
D) the typhus-causing bacterium Rickettsia prowazekii.
E) E.coli strain 0157:H7.

Question 29

Which genome is most likely that of a free-living prokaryote?

A) A genome that is 300 million bp long with over 50 percent repetitive DNA and many introns
B) A genome that is 16,000 bp long and arranged in a circle
C) A genome that is 3 million bp long,arranged in a single circular chromosome,and has little repetitive DNA
D) A genome that is 3 million bp long,is arranged in many linear chromosomes,and has many introns
E) A genome that is a billion bp long,is arranged in many linear chromosomes,and has many introns

Question 30

Which technique or tool is best suited to determine the minimal genome of a free-living bacterium?

A) Metagenomics
B) Haplotype mapping
C) Pharmacogenetics
D) Bacterial artificial chromosomes
E) Selective inactivation of genes

Question 31

Which development is most likely to come about via metagenomic studies?

A) Discoveries about the functions of new genes
B) The determination of the minimal genome size necessary for a free-living organism
C) Explorations of a marine ecosystem
D) Determinations of how quickly a particular gene evolves
E) Indications of which medicine to use with a particular patient

Question 32

Which of the following is an example of a secondary metabolite?

A) Tannins produced by oak trees to ward off herbivores
B) The enzyme phosophofructokinase,which has a role in glycolysis
C) Hemoglobin carrying oxygen in the blood
D) Collagen,a structural protein
E) ATP

Question 33

Which organism would most likely have a proteome that is much larger than the genome?

A) One with a great deal of highly repetitive DNA
B) One with little highly repetitive DNA
C) One with a great deal of alternative splicing
D) One with little alternative splicing
E) One with a lot of secondary metabolites

Question 34

The minimal genome for a free-living bacterium that can survive in the laboratory is likely to consist of _______ genes.

A) 50 or fewer
B) about 50 to 100
C) about 100 to 500
D) about 500 to 2,000
E) more than 2,000

Question 35

Compared to a typical bacterial genome,the genome of a single-cell eukaryote will likely have many more genes devoted to

A) metabolism.
B) membrane transport.
C) DNA replication,repair,and recombination.
D) the targeting of proteins to organelles.
E) energy production and storage.

Question 36

Which statement about metabolomics is true?

A) Medical researchers are well ahead of plant biologists in metabolomics research.
B) It often uses gas chromatography.
C) It is concerned only with the proteins found in cells.
D) It is concerned only with the carbohydrates found in cells.
E) An individual's metabolic profile will look the same regardless of what cell type is examined.

Question 37

Craig Venter,a leader of one of the teams that sequenced the human genome,has now turned his attention to cataloging the microbial life of the oceans.His studies,which involve PCR amplification of microbial DNA and a sequencing of the PCR products,are part of a field of biology called

A) functional genomics.
B) transposon tagging.
C) proteomics.
D) phenomics.
E) metagenomics.

Question 38

Humans have roughly _______ the number of protein-coding genes as D.melanogaster and about _______ the number of genes as S.cerevisae.

A) twice;twice
B) twice;four times
C) four times;four times
D) four times;100 times
E) 100 times;1,000 times

Question 39

Suppose that the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome is signified as X.The ratio of total genome size in the typical eukaryote to the total genome size in the typical prokaryote is Y.Which statement is true?

A) X is greater than Y,and Y is greater than 1.
B) X is greater than 1,and Y is less than 1.
C) Y is greater than X,and X is greater than 1.
D) Y is greater than 1,and X is less than 1.
E) Both X and Y are less than 1.

Question 40

Approximately how many Mycoplasma genitalium genomes would be equivalent to the haploid human genome (in terms of base pairs)?

A) 55
B) 250
C) 550
D) 5,500
E) 25,000

Question 41

A piece of DNA that is 3 kb in length is found in many locations throughout the genome.How would you decide whether this was a LINE or a DNA transposon?

A) If it has more than 10,000 copies in the genome,it is a LINE;if not,it is a DNA transposon.
B) If it has more than 10,000 copies in the genome,it is a DNA transposon;if not,it is a LINE.
C) If it contains the sequence GCTCGATC it is a LINE;if not,it is a DNA transposon.
D) If it uses an RNA intermediate,it is a LINE;if not,it is a DNA transposon.
E) If it is transcribed,then it must be a LINE;if not,then it is a DNA transposon.

Question 42

Which of the following is not a main type of transposon in the human genome?

A) SINEs
B) LINEs
C) DNA transposons
D) Retrotransposons
E) All of the above are main types of transposon in the human genome.

Question 43

Which statement about the nematode C.elegans is false?

A) It has a transparent body.
B) Despite having a small number of cells,it has a nervous system.
C) Despite having a small number of cells,it can reproduce sexually.
D) It normally lives in soil.
E) All of the above are true;none is false.

Question 44

Which statement about yeasts is false?

A) They are always haploid.
B) Most have between 5,000 and 10,000 genes.
C) They typically have linear chromosomes.
D) They typically have membrane-enclosed organelles.
E) They have about as many genes as bacteria devoted to performing the basic functions of cell survival.

Question 45

Which statement about the human genome is true?

A) In any given specialized cell type,most of the genome is being transcribed.
B) Most transcripts are cell-type specific.
C) Most transposons are active most of the time.
D) Noncoding RNAs seldom,if ever,perform regulatory roles.
E) Both a and b

Question 46

The closest living relatives to humans are _______,followed next by _______.

A) chimpanzees;gorillas
B) chimpanzees;gibbons
C) gorillas;orangutans
D) gorillas;chimpanzees
E) orangutans;chimpanzees

Question 47

The fly D.melanogaster is generally thought to be _______ complex than the nematode C.elegans because the fly _______.

A) more;has to produce many more metabolites for defense
B) more;undergoes more complex developmental transformations
C) more;has membrane-enclosed organelles
D) less;lacks membrane-enclosed organelles
E) less;undergoes less complex developmental transformations

Question 48

Which process or element is required for the formation of gene families?

A) Highly repetitive DNA
B) Pseudogenes
C) Transposable elements
D) Gene inactivation
E) Gene duplication

Question 49

Which disease is most unlike the others with respect to its genetic basis?

A) Coronary heart disease
B) Sickle-cell anemia
C) Alzheimer's disease
D) Type I diabetes
E) Rheumatoid arthritis

Question 50

You are told that a genome is about 10 Mb long,has 5,000 genes,has introns,and that 65 percent of its sequence is coding sequence.This genome most likely belongs to a(n)

A) virus.
B) bacterium.
C) yeast.
D) multicellular plant.
E) multicellular animal.

Question 51

In some species of moths,the genes that make chorion for the eggshell are found in multiple copies in order to maximize the production of chorion at specific times.In this regard,these chorion genes are most like

A) pseudogenes.
B) highly repetitive DNA.
C) rRNA genes.
D) transposons.
E) open reading frames.

Question 52

Which statement comparing the genome of humans to that of invertebrates like C.elegans and D.melanogaster is true?

A) A larger fraction of DNA in the human genome is for coding proteins.
B) The human genome has more than ten times the number of protein-coding genes.
C) The average human gene codes for more proteins.
D) The human genome has many fewer transposons.
E) There are fewer introns in human genes.

Question 53

Which statement about pseudogenes is true?

A) There often is little selective pressure to get rid of pseudogenes.
B) The sequences of a pseudogene and its functional counterpart are always very different.
C) Within a gene family,pseudogenes cannot outnumber functional genes.
D) Pseudogenes are found in multiple copies in order to maximize the production of the gene product.
E) Pseudogenes are the same as highly repetitive sequences.

Question 54

The Alu element,which accounts for over 10 percent of the human genome,is an example of a

A) LINE.
B) SINE.
C) halotype.
D) globin gene.
E) DNA transposon.

Question 55

Which statement about the globin genes in humans is false?

A) They are all expressed at the same time.
B) They all arose from a single common ancestor gene.
C) They are an example of a gene family.
D) Some of the different genes carry out different functions.
E) All of the above are true;none is false.

Question 56

Which of the following is most likely to be associated with heterochromatin?

A) A slowly evolving gene
B) A gene family
C) An open reading frame
D) A highly repetitive sequence
E) A promoter

Question 57

If a plant were to acquire mobility,such that it could more easily escape adverse conditions and enemies,genes involved in which function would most likely be lost over evolutionary time? (Hint: Think about the comparative genomics of plants and animals,such as those of Arabidopsis and the nematode C.elegans. )

A) Photosynthesis
B) Cell signaling
C) Defense chemicals
D) Cell growth
E) Metabolism

Question 58

Which of the following is a major difference between LINEs and SINEs?

A) Proteins sometimes are translated from LINEs but they never are from SINEs.
B) SINEs make RNA copies of themselves,whereas LINEs do not.
C) LINEs make RNA copies of themselves,whereas SINEs do not.
D) SINEs are larger than LINEs.
E) SINEs can move from place to place in the genome,whereas LINEs cannot.

Question 59

Which technique,tool,or activity would be most relevant in identifying the genetic variants associated with a complex human disease like schizophrenia?

A) Determination of the metabolome
B) Selective inactivation
C) Metagenomics
D) Haplotype mapping
E) A pseudogene screen

Question 60

Which type of sequence is likely to be found in a eukaryotic genome but not in a prokaryotic genome?

A) Regulatory sequences
B) Coding sequences
C) Open reading frames
D) RNA genes
E) Telomeric sequences

Question 61

Which statement about DNA fingerprinting is false?

A) Short tandem repeats are the primary genetic unit used in DNA fingerprinting.
B) DNA fingerprinting can be applied to analyze historical cases as well as current ones.
C) DNA fingerprinting can be used to determine the identity of the father of a given individual.
D) PCR is often used in DNA fingerprinting.
E) All of the above are true;none is false.

Question 62

The gene most responsible for differences in size among different breeds of dogs is the _______ gene.

A) myostatin
B) phosphofructokinase
C) insulin-like growth factor
D) tyrosine growth factor
E) giant

Question 63

Which field or approach is most likely to lead directly to a reduction in the negative side effects associated with a drug used to treat diabetes?

A) Comparative genomics
B) Metagenomics
C) Metabolomics
D) Pharmacogenomics
E) Selective inactivation

Question 64

DNA fingerprinting most often is based on

A) SNPs.
B) open reading frames.
C) telomeres.
D) repetitive DNA.
E) transposons.

Question 65

Use the following to answer questions :
The hypothetical anti-anxiety drug Epitome is inactive when taken,but it is activated by the rasputin enzyme a few hours after injection.Alleles 1 and 2 of the gene that encodes rasputin have similar activity levels.Individuals with one or both copies of allele 3,which is very rare,have much higher levels of enzyme activity.Individuals who have both copies of allele 4 have much lower levels of enzyme activity.Heterozygotes of allele 4 have normal levels of enzyme activity.
The Epitome drug would be most likely to be ineffective in individuals whose genotype has one copy of allele _______ and one copy of allele _______.

A) 4;4
B) 2;4
C) 2;3
D) 2;2
E) 1;4

Question 66

Which method or technique would likely provide the most information about the genome?

A) SNP genotyping
B) Genome sequencing
C) STR genotyping
D) Haplotype mapping
E) Genome inactivation

Question 67

High-throughput sequencing relies on _______ to amplify the number of identical sequence fragments.

Question 68

Use the following to answer questions :
The hypothetical anti-anxiety drug Epitome is inactive when taken,but it is activated by the rasputin enzyme a few hours after injection.Alleles 1 and 2 of the gene that encodes rasputin have similar activity levels.Individuals with one or both copies of allele 3,which is very rare,have much higher levels of enzyme activity.Individuals who have both copies of allele 4 have much lower levels of enzyme activity.Heterozygotes of allele 4 have normal levels of enzyme activity.
The individuals who are most likely to experience negative side effects from Epitome are those whose genotype has one copy of allele _______ and one copy of allele _______.

A) 1;2
B) 2;3
C) 2;4
D) 2;2
E) 4;4

Question 69

Different functional units of a protein are called

A) open reading frames.
B) domains.
C) haplotypes.
D) proteomes.
E) SNPs.

Question 70

The Human Genome Project could not have proceeded without the new field of _______,which uses complex mathematics and computer programs to analyze DNA sequences.

Question 71

At STR-1,an individual has an allele with a frequency of 0.08.At STR-2,the allele has a frequency of 0.03.At STR-3,the allele has a frequency of 0.05.At STR-4,the allele has a frequency of 0.01.Assuming that the alleles at each of these STRs are inherited independently from one another (i.e. ,that the allele at any given STR is not dependent on the alleles at any of the other STRs),the probability that an individual will have all of these alleles is about 1 in

A) 1,000.
B) 10,000.
C) 100,000.
D) 1 million.
E) 1 billion.

Question 72

Which statement about personal genomics is false?

A) The utility of genomic scans for determining whether a person will acquire coronary heart disease is limited because of the phenomenon of genetic determinism.
B) Microarrays are frequently used in studies that examine which specific SNPs are associated with diseases.
C) Association tests have revealed haplotypes that are associated with modest increases of risk for acquiring various diseases.
D) The vast number of SNPs mapped and the large number of people sampled necessitate rigorous statistical methodology in association tests.
E) All of the above are true;none is false.

Question 73

Haplotype maps are based primarily on

A) the positions of transposons.
B) variations at specific nucleotides.
C) whether or not open reading frames exist.
D) the extent to which a gene is expressed.
E) where on the chromosome the gene is located.

Question 74

Short tandem repeats

A) usually are inherited from both the mother and the father.
B) usually consist of many thousands of repeated units.
C) are a form of transposon.
D) are a form of DNA microarray.
E) consist of open reading frames.

Question 75

Studies of the relative efficacy or nonefficacy of a drug based on specific genotypes would be considered part of the field of

A) metagenomics.
B) metabolomics.
C) proteomics.
D) pharmacogenomics
E) comparative genomics.

Question 76

Increasing the activity of myostatin in a dog would most likely lead to

A) increased muscle development.
B) decreased muscle development.
C) increased size.
D) decreased size.
E) a change in coat color.

Question 77

In which species or population would haplotype mapping be particularly challenging or practically impossible?

A) A salamander species that has a particularly large genome size
B) Dogs,because of the large number of breeds
C) Pufferfish,which have a relatively small genome size (for a vertebrate)
D) Cheetahs,because they have extraordinarily low amounts of genetic diversity
E) A species of ant that has a large number of chromosomes

Question 78

Haplotypes are made up of

A) DNA microarrays.
B) oligonucleotides.
C) single nucleotide polymorphisms.
D) short tandem repeats.
E) DNA fingerprints.