Deck 12: Dna Technology

Question 1

What evidence led to the confirmation that Albert DeSalvo was the Boston Strangler?

A)an analysis of blood types from the crime scene
B)an analysis of fingerprints from the crime scene
C)an analysis of DNA from the crime scene
D)an analysis of witness testimony from the crime scene

Answer 1

C

Question 2

You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association?

A)You can use the sample to determine the individual's blood type.
B)You can use gel electrophoresis to determine the length of the DNA found in the sample.
C)You can use PCR to increase the amount of DNA available for STR analysis.

Answer 2

C

Question 3

Of these steps, which one occurs earliest in the process of producing recombinant DNA?

A)Human DNA fragments are mixed with the cut plasmids.
B)Restriction enzymes are used to isolate the gene of interest and to cut the plasmid DNA.
C)Recombinant plasmids are mixed with bacteria.
D)Bacteria carrying recombinant plasmids are cloned.

Answer 3

B

Question 4

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

A)gene cloning
B)PCR
C)STR analysis
D)whole-genome shotgun method

Question 5

What is the definition of a "transgenic organism?"

A)an organism that is the first of its kind to show a particular phenotype
B)an organism in which a genetic defect has been corrected using gene therapy
C)an organism containing a gene from another species

Question 6

A vaccine works by ________.

A)inhibiting bacterial reproduction
B)stimulating the immune system to develop lasting defenses
C)killing cells infected with a virus
D)preventing translation of mRNA molecules that code for disease-causing proteins

Question 7

Transgenic animals are currently produced for many different reasons. Choose an example of a transgenic animal that currently does not exist.

A)pigs that carry a roundworm gene to produce omega-3 fatty acids
B)dairy cows that carry an Angus cattle gene so that they do not grow horns
C)Atlantic salmon that have been modified to grow twice as fast as normal
D)chickens that have been modified to be able to lay eggs in very hot temperatures

Question 8

Which is the last step in the production of a recombinant DNA plasmid?

A)cloning
B)using DNA ligase to join DNA fragments
C)cutting the gene of interest into fragments
D)allowing the reproduction of the bacterium bearing the recombinant plasmid

Question 9

What is the definition of a genetically modified organism?

A)an organism carrying a gene that was acquired by artificial means
B)an organism in which a particular mutation has appeared for the first time
C)a cloned organism carrying two different alleles

Question 10

"Sticky ends" are ________.

A)single-stranded ends of fragments of double-stranded DNA
B)regions of double-stranded DNA that can be cut by a restriction enzyme
C)portions of DNA used as markers for STR analysis

Question 11

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

A)0 times
B)1 time
C)2 times
D)3 times

Question 12

What is the best definition for recombinant DNA?

A)a type of nucleic acid that includes both RNA and DNA strands
B)DNA that includes nucleotides from two different sources
C)an alternate form of DNA that is the product of a mutation

Question 13

Which enzyme is used to bind DNA fragments together?

A)restriction enzyme
B)lysozyme
C)DNA ligase
D)DNA polymerase

Question 14

When plasmids are used to produce a desired protein, the ________.

A)plasmids multiply and produce the protein outside of the bacterium
B)bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate
C)desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium
D)bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene

Question 15

The world's first genetically engineered pharmaceutical product was ________.

A)humulin
B)human growth hormone
C)a vaccine against hepatitis B
D)erythropoietin

Question 16

"Sticky ends" are ________ that are produced by the action of ________.

A)double-stranded DNA molecules with double-stranded ends; DNA ligase
B)double-stranded DNA molecules with single-stranded ends; DNA ligase
C)double-stranded DNA molecules with double-stranded ends; restriction enzymes
D)double-stranded DNA molecules with single-stranded ends; restriction enzymes

Question 17

Of these steps, which occurs first in the production of a recombinant plasmid?

A)cloning
B)cutting DNA into fragments
C)isolation of a plasmid from a bacterium
D)reproduction of the engineered plasmid in bacteria

Question 18

A DNA fragment with the sticky end sequence TGGCA will bind with another DNA fragment with the sticky end sequence ________.

A)TGCCA
B)ACCGT
C)TGGCA
D)ACGGT

Question 19

What can act as a vector to introduce new genes into a cell?

A)primers
B)ligase
C)restriction enzymes
D)plasmids

Question 20

Restriction enzymes are obtained from ________.

A)archaea
B)eukaryotes
C)viruses
D)bacteria

Question 21

The human genome contains approximately ________ genes.

A)1,000
B)5,000
C)21,000
D)30,000

Question 22

FGA is one of the STRs that are used to compare DNA between different people. Why is FGA useful for comparing DNA between different people?

A)FGA varies in the number of repeats between different people.
B)FGA varies in sequence between different people.
C)FGA is only present in some people's genomes.
D)FGA is present in different places in different people's genomes.

Question 23

To find the nucleotide sequence of human chromosomes, chromosomes had to be digested into small fragments and then ________.

A)separated using gel electrophoresis
B)pasted together with DNA ligase
C)cloned and sequenced
D)cut into smaller fragments with restriction enzymes

Question 24

The study of the full protein sets that genomes encode is ________.

A)proteomics
B)genomics
C)metagenomics
D)systems biology

Question 25

The state of human gene therapy today is that ________.

A)the work that has been completed so far is purely theoretical, but some treatments are in development
B)there have been a small number of successes, including with the disease SCID
C)human gene therapy is used routinely in the treatment of certain rare cancers
D)human gene therapy is used to treat a wide variety of conditions, including diabetes, cancer, and bone marrow diseases

Question 26

The scientific field that studies complete sets of genes is called ________.

A)genomics
B)metagenomics
C)proteomics
D)genetic engineering

Question 27

Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

A)Humans and chimpanzees share a relatively recent common ancestor.
B)Humans evolved from chimpanzees.
C)Humans are unique and different from all other life forms.
D)Humans are a more complex life form than chimpanzees.

Question 28

What is the main function of the CRISPR-Cas9 system?

A)to alter the nucleotide sequences of specific genes in a living cell
B)to make copies of a gene in a PCR reaction
C)to produce proteins from RNA outside of a living cell
D)to prevent bacterial infections in humans

Question 29

In human gene therapy ________.

A)normal versions of human genes are transferred to patients who carry a mutated allele
B)harmless bacteria make important proteins for humans that cannot produce these proteins on their own
C)bacterial plasmids are used to transfer genes to human patients
D)genetically engineered alleles, usually from other species, replace mutated alleles

Question 30

STR analysis is a DNA profiling technique that makes use of the fact that different people have ________.

A)different numbers of repeats of short DNA sequences at certain sites in the genome
B)different alleles for many genes in the genome
C)different restriction fragments
D)different CODIS DNA sequences

Question 31

Golden rice 2 is a genetically modified form of rice that was developed to treat what nutritional deficiency?

A)calcium
B)vitamin B₁₂
C)iron
D)vitamin A

Question 32

There are many ethical dilemmas raised by DNA technology and knowledge of the human genome. Choose the exception.

A)the potential for interfering in evolution
B)the safety of genetically modified foods
C)the potential discrimination against people predisposed to certain diseases
D)the possible negative effects on climate

Question 33

The possibility that Mongolian ruler Genghis Khan spread an unusual chromosome to nearly 16 million men living today resulted from studies of ________.

A)proteomics
B)systems biology
C)the X chromosome
D)the Y chromosome

Question 34

To make restriction fragments, a DNA sample is treated with ________.

A)DNA ligase
B)restriction enzymes
C)DNA polymerase
D)lysozyme

Question 35

Genetically modifying human ________ may directly affect future generations.

A)skin cells
B)eggs and sperm
C)brain cells
D)muscles

Question 36

Gel electrophoresis separates DNA fragments on the basis of differences in their ________.

A)A:C ratio
B)length
C)G:T ratio
D)electrical charge

Question 37

Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________.

A)gel electrophoresis
B)enzymes
C)recombinant DNA
D)plasmids

Question 38

In what type of organism was the CRISPR-Cas9 system discovered?

A)plant
B)human
C)bacteria
D)fungi

Question 39

Approximately what percentage of the human genome consists of noncoding DNA?

A)98.5%
B)87.0%
C)77.5%
D)67.0%

Question 40

What was the goal of the Human Genome Project?

A)to determine the functions of all of the proteins in a human cell
B)to determine the nucleotide sequence of all of the DNA in the human genome
C)to determine the function of all noncoding DNA in the human genome
D)to determine the amino acid sequence of all of the proteins in a human cell

Question 41

Gel electrophoresis separates DNA fragments because ________.

A)double-stranded DNA moves slower than single-stranded DNA
B)of ratios of guanine to cytosine
C)DNA fragments have different lengths
D)of the salt concentration in the gel

Question 42

What method is illustrated by this figure?

A)DNA gel electrophoresis
B)whole-genome shotgun method
C)STR analysis
D)recombinant DNA technology

Question 43

Recombinant DNA technology produces transgenic bacteria with a human gene that codes for a human protein. What problem could be associated with this process?

A)formation of a bacterium that cannot synthesize the product
B)production of a human protein that does not function normally
C)a bacterium with DNA that is resistant to restriction enzymes
D)production of the mouse form of the protein instead of the human form

Question 44

Which is an example of a genetically modified organism that is not a transgenic organism? (Note that none of these organisms currently exist!)

A)a pig that has had cow growth hormone genes inserted into its cells so that it will produce more meat
B)an orange that had its own genes altered so that it will produce extra juice
C)an oat plant that is sprayed with only with natural pesticides so that it grows larger
D)a radish that has genes from a jalapeno pepper added to it to make it spicier

Question 45

The diagram below summarizes ________.

A)gene cloning
B)how a human could be cloned
C)human gene therapy
D)how a vaccine is made

Question 46

Based on the data in the graph, do you think Bt corn is having its intended effect?

A)Yes, because Bt corn affected the mortality of all three arthropods equally.
B)Yes, because Bt corn selectively killed corn borers that ate it while similar percentages of beetles and mites died after eating the Bt corn as compared to the non-Bt corn.
C)No, because Bt corn was designed to kill all arthropods that ate it, and only the corn borers were killed after eating the Bt corn.
D)No, because corn borer percent mortality increased when corn borers ate Bt corn; if Bt corn was effective, then percent mortality should have decreased.

Question 47

What would have been the function of Cas9 when using CRISPR-Cas9 to edit piglets' genomes?

A)to repair mutations in the pol gene
B)to remove the pol gene from the pig genome
C)to insert nucleotides into the pol gene
D)to cut the pol gene

Question 48

Suppose that the researchers targeted the DNA polymerase gene instead of the pol gene. What do you think the most likely outcome would have been?

A)They would have achieved the same outcome as described in this experiment.
B)All of the piglets would have likely been born and lived healthy lives since DNA polymerase is important for cell division.
C)It is likely that the technique would not have worked at all since cells would not be able to replicate their DNA without DNA polymerase.
D)They would not have been able to do the experiment since pig cells do not have the DNA polymerase gene.

Question 49

One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

A)Yes, because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer.
B)Yes, because only the corn borer was affected when eating the Bt corn.
C)No, because more mites and beetles died after eating Bt corn than after eating non-Bt corn.
D)No, because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt.

Question 50

What type of cell would the researchers have needed to use to produce the CRISPR-Cas9 edited piglets?

A)a bacterium cell
B)a pig oocyte
C)a pig neuron
D)a human kidney cell

Question 51

Please read the following scenario and then answer the following questions.
Patients with organ failure or severe diseases may need organ transplants. However, there is often a long waitlist for certain organs, and patients may not be able to acquire a human organ transplant in time. To address this issue, pigs have been studied as a potential source of organs to use for transplants because pig organs are similar in size to human organs and are easy to obtain. However, a major health concern that needs to be addressed before pig organ transplantation becomes viable is the prevention of bacterial or viral transmission from pig organs to the human patient.
One pig virus that is particularly difficult to prevent from being transmitted is porcine endogenous retrovirus (PERV). At some point in time, PERV infected pig eggs or sperm and thus incorporated its own genome into the pig genome, and all species of pigs carry the PERV genome to some extent. Therefore, if a pig kidney is used for a human transplant, all of the pig kidney cells will have the DNA for PERV, and these could possibly infect the human host.
To prevent transmission of PERV, researchers have recently used CRISPR-Cas9 gene editing to introduce mutations in the pol gene. The pol gene codes for the enzyme reverse transcriptase that functions to produce PERV from the pig genome, thus preventing PERV from being produced. As of late 2017, 37 CRISPR-edited piglets were born and 15 were still alive. However, their organs have yet to be transplanted into humans.
For researchers to edit piglets' genomes with CRISPR-Cas9 successfully, the guide RNA sequence must be complementary to ________.

A)the PERV genome
B)the pol gene
C)the RNA polymerase gene
D)a gene for an antibody against PERV

Question 52

Please read the following scenario and then answer the following questions.
Corn crops are susceptible to damage by different species of corn borer, an insect (a type of arthropod)that feeds and lives on corn plants. It is estimated that corn borers may cause up to $1 billion of damage a year to corn crops. Because of pests like the corn borer, researchers have created genetically modified pest-resistant crops. One type of pest-resistant crop, Bt corn, expresses a bacterial toxin that kills corn borers if they consume the toxin. While Bt corn has been planted and used in the United States since 1996, some researchers and members of the public continue to worry about negative effects of the Bt toxin on other animals, including arthropods and humans. In order to investigate the effects of Bt toxins on other animals, researchers conducted experiments where they fed arthropods Bt corn or non-Bt corn. A summary of the effects of eating Bt corn on single species of corn borer, mite, and beetle are shown in the figure below.
What can you conclude from the data in the graph?

A)Corn borers are less likely to survive if they eat Bt corn compared to non-Bt corn.
B)Mites have the highest percent mortality of the arthropods studied.
C)Beetles are more likely to survive than mites when fed Bt corn.
D)Bt corn affects the mortality of all three arthropods equally.

Question 53

Cystic fibrosis is a serious respiratory disease that is caused by the expression of a mutant form of the cystic fibrosis transmembrane regulator (CFTR)protein. Suppose that gene therapy was being used to attempt to treat cystic fibrosis. What biological component would be required for this treatment?

A)a bacterium that contains the mutant form of the CFTR gene in its genome
B)a bacterium that contains the healthy form of the CFTR gene in its genome
C)a virus that contains the mutant form of the CFTR gene in its genome
D)a virus that contains the healthy form of the CFTR gene in its genome

Question 54

What was wrong with Nic Volker's XIAP gene which caused his immune system to attack his digestive system?

A)the XIAP gene was missing a single nucleotide
B)the XIAP gene had a nucleotide substitution
C)the XIAP gene was missing completely
D)the XIAP gene was duplicated