Deck 20: Genomics and Proteomics

Question 1

Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain?

A) The recombination frequencies would be low, and you would deduce that the markers were very close to one another.
B) The recombination frequencies would be low, and you would deduce that the markers were very far from one another.
C) The recombination frequencies would be high, and you would deduce that the markers were very close to one another.
D) The recombination frequencies would be high, and you would deduce that the markers were very far from one another.
E) The recombination frequencies would be too low to detect, and you would not be able to estimate the distance between genetic markers.

Answer 1

A

Question 2

For a genetic map of a chromosome, distances are measured in units of:

A) restriction sites.
B) RFLPs.
C) centiMorgans.
D) base pairs.
E) contigs.

Answer 2

C

Question 3

You've cloned a 2-kb fragment of DNA into a bacterial cloning vector and want to construct a restriction map of the insert. You amplify the 2-kb insert using PCR, purify it, and subject it to differential digestion with the enzymes EcoRI and HindIII, gel-fractionate the digests, and visualize the restriction patterns by staining the gels with ethidium bromide to generate the following results.

-Using these data, indicate the order of restriction sites in the DNA insert. $$\begin{array} { l l } & \text { Restriction fragment lengths } \\\hline\text { EcoRI } & 350 \mathrm { bp } , 500 \mathrm { bp } , 1250 \mathrm { bp } , 100 \mathrm { bp } \\\text { HindIII } & 350 \mathrm { bp } , 650 \mathrm { bp } , 1000 \mathrm { bp } \\\text { EcoRI/HindIII } & 100 \mathrm { bp } , 150 \mathrm { bp } , 200 \mathrm { bp } , 300 \mathrm { bp } , 350 \mathrm { bp } , 900 \mathrm { bp }\end{array}$$

A) EcoRI, HindIII, EcoRI, HindIII, EcoRI
B) HindIII, EcoRI, HindIII, EcoRI, HindIII
C) HindIII, EcoRI, HindIII, HindIII, EcoRI
D) HindIII, EcoRI, EcoRI, HindIII, EcoRI
E) EcoRI, EcoRI, HindIII, EcoRI, HindIII

Answer 3

EcoRI, HindIII, EcoRI, HindIII, EcoRI

Question 4

For a physical map of a chromosome, distances are measured in units of:

A) map units.
B) RFLPs.
C) centiMorgans.
D) base pairs.
E) contigs.

Question 5

Which of the following is NOT a reason that metagenomics is particularly useful for studying microbes?

A) Many bacteria that cannot be cultured in the laboratory can now be studied.
B) The composition of natural microbial communities can be reconstructed.
C) The microbiome of individuals can be compared to understand the basis of disease.
D) Previously unknown species of bacteria and new gene families have been discovered.
E) The genomes of somatic cells in a human individual can vary significantly.

Question 6

What is metagenomics and what important issues can it address about microbial communities?

Question 7

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites?

A) a 12-kb fragment
B) an 8-kb fragment
C) an 8-kb and a 2-kb fragment
D) a 10-kb and a 2-kb fragment
E) a 10-kb, an 8-kb, and a 2-kb fragment

Question 8

Short regions of chromosome 1 were sequenced in a population of Drosophila. These sequences from three different flies are shown below. Identify the SNP haplotype for Fly #3. Fly #1: 5ʹ ATGGCACGAAGCTAAGAATA 3ʹ
Fly #2: 5ʹ ATGGCTCGACGCTCATAATA 3ʹ
Fly #3: 5ʹ ATGGCGCGATGCTAAGAATC 3ʹ

A) 5ʹ GTAGC 3ʹ
B) 5ʹ CGATG 3ʹ
C) 5ʹ GTAGA 3ʹ
D) 5ʹ NNAGA 3ʹ
E) 5ʹ CATCG 3ʹ

Question 9

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. How many restriction sites are there for the enzyme in this fragment?

A) one
B) two
C) three
D) four
E) It cannot be determined with this information.

Question 10

Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, how would the genetic map correspond to the physical map?

A) The genetic map will underestimate the distance between markers because the low recombination rate will suggest that the markers are very close to one another when they could be physically far apart.
B) The genetic map will underestimate the distance between markers because the markers will segregate independently in meiosis.
C) The genetic map will overestimate the distance between markers because the low recombination rate will make it appear that they are far from one another when they could be physically close to one another.
D) The genetic map will overestimate the distance between markers because rates of crossing over are not the same at all places on all chromosomes.
E) The genetic and physical maps will precisely correspond since recombination rates at the centromere are lower and more predictable.

Question 11

Linkage disequilibrium is the nonrandom association among SNPs within a haplotype. Over time, would you expect linkage disequilibrium among markers to be maintained, to increase, or to decrease?

A) decrease, because random mutation will generate new SNPs that will give rise to new haplotypes
B) decrease, because crossing over will break up the physical linkage among markers
C) increase, because unequal crossing over between SNPs will decrease the physical distance between them
D) increase, because positive selection will cause the haplotype to become more common
E) be maintained, because there is no selective pressure to change the frequency of haplotypes in the population

Question 12

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?

A) two
B) three
C) four
D) six
E) five

Question 13

Which of the following is a disadvantage of map-based sequencing over shotgun sequencing?

A) Map-based sequencing minimizes the amount of repeat sequencing in which the same region is sequenced several times.
B) Map-based sequencing yields well-characterized physical maps as well as actual sequences.
C) The relationship of overlapping fragments to sequences is known before sequencing begins.
D) Map-based sequencing is more time-consuming because extensive mapping is required before sequencing starts.
E) Restriction patterns can be used to identify overlapping clones.

Question 14

You've cloned a 2-kb fragment of DNA into a bacterial cloning vector and want to construct a restriction map of the insert. You amplify the 2-kb insert using PCR, purify it, and subject it to differential digestion with the enzymes EcoRI and HindIII, gel-fractionate the digests, and visualize the restriction patterns by staining the gels with ethidium bromide to generate the following results.

-Using these data, which two loci would be closest on a genetic map if the frequency of crossing over is equal in this region? $$\begin{array} { l l } & \text { Restriction fragment lengths } \\\hline\text { EcoRI } & 350 \mathrm { bp } , 500 \mathrm { bp } , 1250 \mathrm { bp } , 100 \mathrm { bp } \\\text { HindIII } & 350 \mathrm { bp } , 650 \mathrm { bp } , 1000 \mathrm { bp } \\\text { EcoRI/HindIII } & 100 \mathrm { bp } , 150 \mathrm { bp } , 200 \mathrm { bp } , 300 \mathrm { bp } , 350 \mathrm { bp } , 900 \mathrm { bp }\end{array}$$

A) The EcoRI sites that are 100 bp apart would show the smallest distance in cM.
B) The HindIII sites that are 750 bp apart would show the smallest distance in cM.
C) The HindIII site and the EcoRI site that are 200 bp apart would show the smallest distance in cM.
D) The EcoRI site and the HindIII site that are 300 bp apart would show the smallest distance in cM.
E) The EcoRI sites that are 150 bp apart would show the smallest distance in cM.

Question 15

Which of the following statements is TRUE of genetic maps?

A) They are derived from direct analysis of DNA.
B) They are based on frequencies of recombination between loci.
C) They have a high level of detail rivaling that of physical maps.
D) They always accurately correspond to physical distances between genes.
E) They are more accurate than physical maps.

Question 16

How are genetic maps different from physical maps?

Question 17

Loci that are far apart:

A) have a higher recombination rate than loci that are close together.
B) exhibit a recombination frequency of greater than 50%.
C) always segregate together in meiosis.
D) influence the phenotype to a lesser degree than loci that are close together.
E) have less attraction than close loci.

Question 18

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a:

A) chromosome.
B) sequence.
C) map.
D) contig.
E) clone.

Question 19

In the following list of cloned fragments, which are the fragments needed to make the longest possible contig with the least amount of overlap? $\begin{array}{c}\begin{array}{lll}Cloned ~fragment\\\hline A\\B\\C\\D\\E\\F\\\end{array}&\begin{array}{lll}Markers~~ present\\\hline M4~~ M5\\\hline M1~~ M2 ~~M3\\\hline M6~~ M7~~ M8\\\hline M3~~ M4~~ M5~~ M6\\\hline M3~~ M4~~ M5\\\hline M8~~ M9~~ M10\\\hline\end{array}\end{array}$

A) A, B, F
B) A, B, C, E
C) B, C, D, F
D) B, C, D, E, F
E) A, B, C, D, E, F

Question 20

In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. Why is a map unit so different in these two different types of organisms?

A) A map unit is the amount of measured recombination between two linked points in a genome, and humans have more SNPs than Saccharomyces cerevisiae that can serve as genetic markers.
B) An increased number of noncoding introns in humans suppresses recombination and leads to larger physical distances for each map unit.
C) Saccharomyces cerevisiae has fewer predicted genes than humans, which means that less recombination is required in yeast cells.
D) The amount of homologous recombination per DNA length must be lower in humans than in Saccharomyces cerevisiae.
E) Humans have more chromosomes and, therefore, have more linkage groups than Saccharomyces cerevisiae.

Question 21

Below is a genetic map for three loci. Which two of these loci would show the smallest physical distance in base pairs, if the frequency of crossing over is equal in this chromosome region? Explain your answer.

Question 22

You obtain six BACs (of known order, shown below) and six sequence-tagged sites (STSs, of unknown order) derived from an unfinished portion of the genome sequence of Monodelphis domestica, the gray short-tailed opposum. Using PCR, you test each BAC for the presence (+) or absence (-) of each of the STSs. You obtain the following results: Construct a physical map that shows the order of the STSs and their approximate locations within each BAC.

Question 23

Which technique would not be used to find a gene for a functional protein in a sequenced region of a genome?

A) Scan the region for ORFs.
B) Scan the region for start and stop codons.
C) Scan an SNP database that contains sequences in the region.
D) Scan the region for promoter sequences.
E) Scan the region for intron splice sites.

Question 24

How are SNPs used to search for genes causing disease?

Question 25

Explain how copy-number variations (CNVs) can influence phenotypes in human populations.

Question 26

How has the study of microbiomics shed light on the understanding of obesity?

Question 27

You are attempting to generate a physical map of the bacteriophage $\lambda$ genome using restriction enzyme digestions. You digest the phage DNA with EcoRI or NcoI or both, and observe the fragment sizes listed below. You know that bacteriophage $\lambda$ has a linear, not circular, genome. $$\begin{array} { l l l } { \text { EcoRI } } & { \text { NcoI } } & { \text { EcoRI/NcoI } } \\\hline { 21.2 \mathrm {~kb} }&{ 19.3 \mathrm {~kb} } &{ 19.3 \mathrm {~kb} } \\7.4 \mathrm {~kb} & 16.4 \mathrm {~kb} & 7.4 \mathrm {~kb} \\5.8 \mathrm {~kb} & 4.6 \mathrm {~kb} & 5.1 \mathrm {~kb} \\5.7 \mathrm {~kb} & 4.2 \mathrm {~kb} & 3.9 \mathrm {~kb} \\4.9 \mathrm {~kb} & 4.0 \mathrm {~kb} & 3.5 \mathrm {~kb} \\3.5 \mathrm {~kb} & & 2.7 \mathrm {~kb} \\& & 2.2 \mathrm {~kb} \\& & 1.9 \mathrm {~kb} \\& & 1.8 \mathrm {~kb} \\& & 0.7 \mathrm {~kb}\end{array}$$ a. How many times does the EcoRI enzyme cut the $\lambda$ DNA? How many times does the NcoI enzyme cut the $\lambda$ DNA?
b. Use the fragment size data to generate a physical map of the bacteriophage $\lambda$ genome, indicating the order and relative positions of the restriction enzyme recognition sites.

Question 28

Construct a genetic map for a region of a genome, given the following information: the observed recombination frequency between genes D and E is 10%. The observed recombination frequency between genes D and F is 13%. The observed recombination frequency between genes E and F is 23%. Draw the map given by this information.

Question 29

Which class of genes is the result of an ancient gene duplication?

A) orthologs
B) paralogs
C) heterologs
D) pseudologs
E) lincolnlogs

Question 30

Explain why the greatest diversity of human SNPs is found among African populations.

Question 31

The set of all proteins encoded by the genome is called the:

A) genome.
B) transcriptome.
C) metabolome.
D) proteome.
E) glycome.

Question 32

Use the following to answer questions
The following microarray data are shown for four human genes. Two samples were hybridized to the microarray in this experiment. One sample was cDNA generated from mRNA of a tissue culture cell line that was originally derived from a B-cell leukemia. The other sample was cDNA generated from normal, mature neural tissue.
$\bullet$ Vertical stripes mean hybridization to cancerous B-cell cDNA only.
$\bullet$ Horizontal stripes mean hybridization to normal neural cell cDNA only.
$\bullet$ Completely filled in means hybridization to both cDNA types.
$\bullet$ Blank means hybridization to neither cell's cDNA.

-One spot on the microarray contains sequences unique to a gene for an RNA polymerase subunit. One spot contains sequences unique to the skeletal muscle myosin gene. Which spot would be expected to contain the RNA polymerase gene sequences?

A) spot 1
B) spot 2
C) spot 3
D) spot 4
E) none of the spots

Question 33

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms, are called:

A) orthologs.
B) paralogs.
C) heterologs.
D) pseudologs.
E) lincolnlogs.

Question 34

A BLAST search is done to:

A) find similar gene or protein sequences.
B) find the chromosomal location of a sequence.
C) predict the three-dimensional structure of a protein from its amino acid sequence.
D) find restriction sites and SNPs in a sequence.
E) determine the conditions under which a gene is expressed.

Question 35

Explain why genetic and physical map distances may differ in relative distances between two genes on a chromosome.

Question 36

Which of the following genes are paralogs?

A) A₁ and A₂
B) A₁ and B₁
C) A₁ and B₂
D) A₂ and B₁
E) B₂ and B₂

Question 37

How can a BLAST search reveal information about protein function?

Question 38

How has metagenomics of ocean samples contributed to our understanding of energy in biological systems?

Question 39

You have determined that a bacterial strain you are working with contains a single type of plasmid. You isolate the plasmid DNA and digest separate portions of it with each of two different restriction enzymes, BamHI and HpaI, and also perform a double digest using both enzymes. You then fractionate the enzyme digests on an agarose gel and stain the gel with ethidium bromide to visualize the restriction fragment patterns. Your results are shown below. Size markers (in nucleotide base pairs) are indicated at the left side of the gel. Using these data, construct a possible restriction map for the plasmid.

Question 40

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the MOST useful for this task?

A) information about bacterial orthologs of the gene
B) an EST database of the human genome
C) microarray data of tissues in which the gene is expressed
D) data about the inheritance of SNP markers in families with the disease
E) whole-genome-shotgun clones of the human genome

Question 41

The transcriptome of a genome contains more components than the proteome. Explain why this is true.

Question 42

Use the following to answer questions
A researcher is interested in studying Drosophila genes that are turned on in response to UV light exposure. She uses a microarray to carry out her experiment and is particularly interested in eight genes shown in the microarray below.
$\bullet$ Vertical stripes mean hybridization to UV light-exposed cell cDNA only.
$\bullet$ Horizontal stripes mean hybridization to nonexposed cell cDNA only (control).
$\bullet$ Completely filled in means hybridization to both cDNA types.
$\bullet$ Blank means hybridization to neither cell's cDNA.

-Which genes appear to be upregulated in the UV light-exposed group?

A) 1, 3, and 5
B) 2 and 7
C) 4, 6, and 8
D) 6 only
E) 4 and 8 only

Question 43

Use the following to answer questions
The following microarray data are shown for four human genes. Two samples were hybridized to the microarray in this experiment. One sample was cDNA generated from mRNA of a tissue culture cell line that was originally derived from a B-cell leukemia. The other sample was cDNA generated from normal, mature neural tissue.
$\bullet$ Vertical stripes mean hybridization to cancerous B-cell cDNA only.
$\bullet$ Horizontal stripes mean hybridization to normal neural cell cDNA only.
$\bullet$ Completely filled in means hybridization to both cDNA types.
$\bullet$ Blank means hybridization to neither cell's cDNA.

-One spot on the microarray contains sequences unique to a gene for an RNA polymerase subunit. One spot contains sequences unique to the skeletal muscle myosin gene. Which spot would be expected to contain the myosin gene sequences?

A) spot 1
B) spot 2
C) spot 3
D) spot 4
E) none of the spots

Question 44

Briefly describe how RNA sequencing is carried out.

Question 45

Which of the following statements about eukaryotic genomes is TRUE?

A) A substantial part of the genomes of most multicellular organisms consists of protein coding sequences.
B) People differ not only at millions of individual SNPs but also in the number of copies of many larger segments of the genome.
C) In humans, the number of proteins is approximately equal to the total number of genes.
D) There is a directly proportional relationship between the size of a eukaryotic organism and the number of genes it has.
E) The number of genes among multicellular eukaryotes is related to phenotypic complexity.

Question 46

Use the following to answer questions
A researcher is interested in studying Drosophila genes that are turned on in response to UV light exposure. She uses a microarray to carry out her experiment and is particularly interested in eight genes shown in the microarray below.
$\bullet$ Vertical stripes mean hybridization to UV light-exposed cell cDNA only.
$\bullet$ Horizontal stripes mean hybridization to nonexposed cell cDNA only (control).
$\bullet$ Completely filled in means hybridization to both cDNA types.
$\bullet$ Blank means hybridization to neither cell's cDNA.

-Which genes appear to be involved in the UV light stress response in Drosophila?

A) 1, 3, and 5
B) 2 and 7
C) 4, 6, and 8
D) 6 only
E) 4 and 8 only

Question 47

In general, what kind of information can be obtained from homologous genes?

Question 48

Below are the steps involved in the RNA-seq process. Place these steps in the CORRECT order. 1. Conversion of the RNA to cDNA
2) Fragmentation and preparation of the cDNAs for sequencing
3) Isolation of the RNA molecules of interest from cells
4) Assembly of the sequencing reads into RNA transcripts
5) Sequencing of the cDNA

A) 3, 1, 2, 5, 4
B) 1, 2, 4, 5, 3
C) 3, 4, 1, 2, 5
D) 1, 5, 4, 3, 2
E) 1, 5, 2, 3, 4

Question 49

Which of the following information CANNOT be learned from RNA sequencing?

A) the types and number of RNA molecules produced by transcription
B) the presence of alternatively processed RNA molecules
C) information about differential expression of the two alleles in a diploid individual
D) different RNA molecules generated by bidirectional or overlapping transcription of DNA sequences
E) the active sites of the enzyme the RNA encodes

Question 50

A new species of plant was discovered and its genome was sequenced. A BLAST search was performed on a small section of one of the chromosomes and one gene in this region showed 98% similarity to a gene in Arabidopsis. Based on this information, which of the following statements is FALSE?

A) The gene in the new species of plant and the gene in Arabidopsis are homologous.
B) The gene in the new species of plant and the gene in Arabidopsis likely encode proteins with similar functions.
C) The gene in the new species of plant and the gene in Arabidopsis are paralogs.
D) The new species of plant and Arabidopsis are evolutionarily related.
E) The new species of plant and Arabidopsis likely have a common ancestor.

Question 51

Use the following to answer questions
The following microarray data are shown for four human genes. Two samples were hybridized to the microarray in this experiment. One sample was cDNA generated from mRNA of a tissue culture cell line that was originally derived from a B-cell leukemia. The other sample was cDNA generated from normal, mature neural tissue.
$\bullet$ Vertical stripes mean hybridization to cancerous B-cell cDNA only.
$\bullet$ Horizontal stripes mean hybridization to normal neural cell cDNA only.
$\bullet$ Completely filled in means hybridization to both cDNA types.
$\bullet$ Blank means hybridization to neither cell's cDNA.

-The gene sequences contained in spot 2 are present only in the B-cell cancer sample. What is a possible function for this gene, based on the microarray data?

A) This gene may be involved in neurotransmitter release at the synapse since B-cells are known to be involved in cell-to-cell signaling.
B) This gene may be involved in activating cell growth, so it is switched on in the cancer cell line that is growing rapidly.
C) This gene is involved in the immune function of the B-cell since that is the cell type from which this cancer line was initially derived.
D) This gene may be involved in neurotransmitter release at the synapse or in activating cell growth.
E) This gene may be involved in activating cell growth or in the immune function of the B-cell.

Question 52

Describe how a reporter sequence could be used to reveal information about gene expression.

Question 53

To test for gene expression patterns in different tissue types, mRNA is prepared from mouse cells that are precursors to skin cells and from mouse cells that are precursors to red blood cells. The mRNA from each cell type is converted to cDNA and hybridized to a microarray. Spots containing unique sequences from five genes of the microarray are shown in the following diagram. Color them in as specified.
$\bullet$ Vertical stripes for hybridization to skin cell cDNA only
$\bullet$ Horizontal stripes for hybridization to red blood cell cDNA only
$\bullet$ Filled in completely for hybridization to both cDNA types
$\bullet$ Blank for hybridization to neither skin nor red blood cell cDNA

Question 54

The expression of miRNAs was compared in normal cells and cancer cells using a microarray. miRNAs from cancer cells were labeled with green fluorescent tags, and miRNAs from normal cells were labeled with red fluorescent tags. miRNA #1 was overexpressed in cancer cells, miRNA #2 was not expressed in either cell type, miRNA #3 was underexpressed in cancer cells, and miRNA #4 was equally expressed in both cell types. Which of the following microarrays illustrate these findings?

A)

B)

C)

D)

E)

Question 55

Prokaryotes with large genomes:

A) are endosymbiotic.
B) live in constant environments.
C) require less time for cell division.
D) live in complex habitats.
E) have multiple linear chromosomes.

Question 56

Compare orthologs and paralogs. Include one feature they have in common and one way in which they are different.

Question 57

Use the following to answer questions
A researcher is interested in studying Drosophila genes that are turned on in response to UV light exposure. She uses a microarray to carry out her experiment and is particularly interested in eight genes shown in the microarray below.
$\bullet$ Vertical stripes mean hybridization to UV light-exposed cell cDNA only.
$\bullet$ Horizontal stripes mean hybridization to nonexposed cell cDNA only (control).
$\bullet$ Completely filled in means hybridization to both cDNA types.
$\bullet$ Blank means hybridization to neither cell's cDNA.

-Which genes appear to be downregulated in the UV light-exposed group?

A) 1, 3, and 5
B) 2 and 7
C) 4, 6, and 8
D) 6 only
E) 4 and 8 only

Question 58

Which of the following is involved in the RNA sequencing process?

A) conversion of the RNA to complementary DNA (cDNA) sequences
B) direct sequencing of RNA molecules
C) extraction of DNA from a cell
D) generation of RNA from cDNA sequences
E) isolation of RNA from a cell followed by fragmentation of RNA

Question 59

The transcription factor Twist helps specify development of the mesoderm in the Drosophila embryo. You wish to identify other genes that Twist (as a transcription factor) switches on or off. You have wild-type embryos available, as well as embryos that are mutant for the Twist gene. Design an experiment using microarrays that could allow you to identify genes switched on or off by the Twist transcription factor.

Question 60

Which of the following statements about prokaryotic genomes is FALSE?

A) Bacteria can obtain new genetic information through horizontal gene transfer.
B) All prokaryotes have a genome that consists of a single circular chromosome.
C) Prokaryotes with the smallest genomes tend to be in species that occupy restricted habitats, such as bacteria that live inside other organisms.
D) In many sequenced genomes, the function of a significant percentage of genes is currently unknown.
E) The number of genes between species can vary from a few hundred to a few thousand.

Question 61

Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) is a technique wherein proteins are separated in one dimension by a chemical property and in a second dimension by a different property.

- By what property are proteins separated in the first dimension?

A) electrical charge
B) molecular mass
C) posttranslational modification
D) isotope
E) hydrophobic index

Question 62

In mass spectrometry, a molecule is ionized and its migration rate in an electrical field is determined. What information does the migration rate tell about the molecule?

A) It indicates mass because small molecules migrate more rapidly than larger molecules.
B) It indicates electrical charge because negatively charged molecules migrate more rapidly than positively charged molecules.
C) It indicates the solubility of the molecule because insoluble molecules form aggregates and migrate much more slowly than soluble molecules.
D) It indicates the relative abundance of the molecule in the sample.
E) It indicates the complexity of the proteome because greater proteome diversity takes a longer time to process.

Question 63

Given the 2D-PAGE gel below, which one of the following conclusions is true? [Figure after G. Gibson and S. Muse. 2004. A Primer of Genome Science, 2e. Sinauer Associates, Inc. p. 274, Fig. 5.4.]

A) Cathepsin B has a smaller molecular mass than actin and approximately the same charge as actin.
B) Proteosome B chain has a higher charge and a larger molecular mass than actin.
C) ER60 has a smaller molecular mass than cathepsin heavy chain and approximately the same charge as cathepsin heavy chain.
D) Calreticulin has a lower charge than glutathione-S-transferase and a smaller molecular mass than glutathione-S-transferase.
E) ATP synthase D chain has a higher charge than transthyretin and approximately the same molecular mass as transthyretin.

Question 64

How much of the human genome codes for proteins?

A) less than 2%
B) approximately 24%
C) approximately 50%
D) approximately 74%
E) more than 82%

Question 65

Which of the following is TRUE of noncoding DNA?

A) It is not essential for life in most organisms.
B) It can contain sequences to which proteins can bind and influence gene expression.
C) It can contain genes that code for rRNA and tRNA.
D) It contains a high percentage of introns.
E) These regions have a low gene density.

Question 66

The genome of the rice plant was completely sequenced in 2002. What features of the rice genome make it useful for sequencing efforts in other grass species, such as wheat and corn?

A) These other grass species have genomes that are considerably larger than that of rice.
B) The grasses have a common evolutionary ancestor.
C) A smaller, more easily sequenced genome can serve as a model for the mapping and isolation of genes in the larger genomes.
D) Many genes are present in the same order in related grass species' genomes (the genomes are collinear).
E) All of the answers are correct.

Question 67

Compare the fields of structural, functional, and comparative genomics. What is the purpose of each?

Question 68

The average gene in the human genome is approximately _____ base pairs in length.

A) 700
B) 7000
C) 17,000
D) 27,000
E) 57,000

Question 69

Which of the following is NOT an example of the importance of gene duplication in genome evolution?

A) The human olfactory multigene family consists of about 1000 genes used in our sense of smell.
B) Ribosomal protein S4 is found as a single-copy gene in all three domains of life.
C) After a segmental duplication, the original copy of the gene can continue its function while the new copy undergoes mutation, leading to new functions.
D) The globin gene family in humans consists of 13 genes that encode globin-like molecules, most of which produce proteins that carry oxygen.
E) These are all examples of how gene duplication plays a role in genome evolution.

Question 70

The study of the expression, localization, and interactions of the complete set of proteins found in a given cell is called:

A) genomics.
B) bioinformatics.
C) metagenomics.
D) proteomics.
E) transcriptomics.

Question 71

Use the following to answer questions
$$\begin{array} { | l r r | } \hline \text { Species } & \begin{array} { c } \text { Genome Size (millions of } \\\text { base pairs) }\end{array} & \text { Number of Predicted Genes } \\\hline \text { Saccharomyces cerevisiae (yeast) } & 12 & 6,144 \\\hline \text { Drosophila melanogaster (fruit fly) } & 170 & 13,525 \\\hline \text { Mus musculus (mouse) } & 2,627 & 26,762 \\\hline \text { Pan troglodytes (chimpanzee) } & 2,733 & 22,524 \\\hline \text { Homo sapiens (human) } & 3,223 & \sim 20,000 \\\hline\end{array}$$

-Based on the table above, which species has the LARGEST amount of noncoding DNA within its genome?

A) yeast
B) fruit fly
C) mouse
D) human
E) It cannot be determined from the information provided in the table.

Question 72

Use the following to answer questions
$$\begin{array} { | l r r | } \hline \text { Species } & \begin{array} { c } \text { Genome Size (millions of } \\\text { base pairs) }\end{array} & \text { Number of Predicted Genes } \\\hline \text { Saccharomyces cerevisiae (yeast) } & 12 & 6,144 \\\hline \text { Drosophila melanogaster (fruit fly) } & 170 & 13,525 \\\hline \text { Mus musculus (mouse) } & 2,627 & 26,762 \\\hline \text { Pan troglodytes (chimpanzee) } & 2,733 & 22,524 \\\hline \text { Homo sapiens (human) } & 3,223 & \sim 20,000 \\\hline\end{array}$$

-Based on the table above, which species has the HIGHEST gene density?

A) yeast
B) fruit fly
C) mouse
D) chimpanzee
E) human

Question 73

What role might segmental duplication play in evolution?

Question 74

What information CANNOT be learned from the structure of a protein?

A) The location of the active site of an enzyme
B) Possible interaction sites with other molecules
C) Targets for potential drugs
D) A source of insight into the function of an unknown protein
E) The number of introns in the gene that encodes the protein

Question 75

Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.

Question 76

A typical prokaryotic genome has:

A) 1 million base pairs of DNA, containing 1000 genes.
B) 1 million base pairs of DNA, containing a few hundred genes.
C) 1 thousand base pairs of DNA, containing a few hundred genes.
D) 1 thousand base pairs of DNA, containing a few thousand genes.
E) 1 million base pairs of DNA, containing a few million genes.

Question 77

Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) is a technique wherein proteins are separated in one dimension by a chemical property and in a second dimension by a different property.

-By what property are proteins separated in the second dimension?

A) electrical charge
B) molecular mass
C) posttranslational modification
D) isotope
E) hydrophobic index

Question 78

Use the following to answer questions
$$\begin{array} { | l r r | } \hline \text { Species } & \begin{array} { c } \text { Genome Size (millions of } \\\text { base pairs) }\end{array} & \text { Number of Predicted Genes } \\\hline \text { Saccharomyces cerevisiae (yeast) } & 12 & 6,144 \\\hline \text { Drosophila melanogaster (fruit fly) } & 170 & 13,525 \\\hline \text { Mus musculus (mouse) } & 2,627 & 26,762 \\\hline \text { Pan troglodytes (chimpanzee) } & 2,733 & 22,524 \\\hline \text { Homo sapiens (human) } & 3,223 & \sim 20,000 \\\hline\end{array}$$

-Based on the table above, which species has the LOWEST gene density?

A) yeast
B) fruit fly
C) mouse
D) chimpanzee
E) human

Question 79

A _____ is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.

A) microarray
B) multigene family
C) proteome
D) haplotype
E) contig