Deck 18: Gene Mutations and Dna Repair

Question 1

Achondroplasia is a form of dwarfism that is inherited in humans as an autosomal dominant disorder. A survey in a small country showed that, within a two-year period, there were 12 children with normal parents born with this disorder out of a total of 420,000 births. What is the mutation rate in mutations/locus/generation?

A) 1.4 × 10^-5
B) 2.8 × 10^-6
C) 2.5 × 10^-5
D) 2.8 × 10^-5
E) 7.4 × 10^-6

Answer 1

A

Question 2

Insertion or removal of one or more nucleotide base pairs in DNA within a gene often results in a _____ mutation.

A) transition
B) frameshift
C) reversion
D) transversion
E) suppressor

Answer 2

B

Question 3

Which of the following kinds of mutations is MOST likely to be a null loss-of-function mutation?

A) transition
B) transversion
C) frameshift
D) missense
E) induced

Answer 3

C

Question 4

The type of mutation that reverses the effects of a frameshift mutation without changing the frameshift and occurs with the same gene as the frameshift is called a(n):

A) intergenic suppressor mutation.
B) nonsense mutation.
C) missense mutation.
D) intragenic suppressor mutation.
E) silent mutation.

Question 5

Fragile-X syndrome is an example of a disease caused by what type of mutation?

A) nonsense mutation
B) frameshift mutation
C) expanding nucleotide repeat
D) loss-of-function mutation
E) gain-of-function mutation

Question 6

Assume that a base-pair substitution mutation converts a DNA triplet (AAT) to another DNA triplet (AAA). A second mutation now changes the AAA triplet to the GAA triplet. (UUA and CUU code for leucine and UUU codes for phenylalanine.) This second mutation is an example of a(n):

A) transversion.
B) intragenic suppressor.
C) loss-of-function mutation.
D) intergenic suppressor.
E) frameshift.

Question 7

A mutation that changes a GC base pair to AT is a(n):

A) transition.
B) transversion.
C) induced mutation.
D) missense mutation.
E) synonymous mutation.

Question 8

_____ mutations produce new activities and are usually dominant.

A) Induced
B) Spontaneous
C) Forward
D) Gain-of-function
E) Lethal

Question 9

Huntington's disease can strike at an earlier age and bring about a more rapid degeneration and death in successive generations within a family. This phenomenon can be explained by which mechanism?

A) presence of a transposable element in the gene
B) chronic exposure to mutagens in the environment
C) expansion of a trinucleotide repeat in the coding sequence of the gene
D) presence of an extra chromosome in the germ line
E) absence of a gene product that is involved in DNA repair

Question 10

An example of a genetic disorder in humans that results from a loss-of-function mutation is:

A) cystic fibrosis.
B) achondroplasia.
C) Huntington's disease.
D) myotonic dystrophy.
E) No correct answer is provided.

Question 11

The mutation shown in the diagram below can BEST be described as a _____ mutation.

A) missense
B) nonsense
C) silent
D) neutral
E) reverse

Question 12

Which of the following statements about somatic mutations is FALSE?

A) Some may give rise to cancers in humans and other animals.
B) They may be inherited by daughter cells after cell division.
C) They may result in inactive gene products of the mutated genes.
D) They may result from both frameshift and base-pair substitution mutations.
E) They may be inherited in the offspring of mutated individuals.

Question 13

A _____ mutation changes a codon that specifies an amino acid into one that terminates translation.

A) missense
B) nonsense
C) silent
D) neutral
E) reverse

Question 14

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?

A) missense mutation
B) nonsense mutation
C) neutral mutation
D) silent mutation
E) loss-of-function mutation

Question 15

What is the consequence of a transversion mutation in duplex DNA?

A) A purine is replaced by a pyrimidine, and a pyrimidine is replaced by a purine.
B) A base pair is lost within the DNA of a gene, which causes a reading frameshift.
C) A purine is replaced by another purine, and a pyrimidine is replaced by another pyrimidine.
D) A base pair is added to the DNA within a gene, which causes a reading frameshift.
E) The sequence of the DNA remains the same since the change involves proteins.

Question 16

Which of the following statements about an animal bearing a somatic mutation is TRUE?

A) Some, but not all, of the animal's offspring will also carry the mutation.
B) All of the animal's offspring will carry the mutation.
C) Both the animal and its offspring will show the mutant trait.
D) The animal but not its offspring can be affected by the mutation.
E) The gametes produced by the animal will all carry the mutation.

Question 17

How do germ-line mutations differ from somatic mutations?

A) Germ-line mutations involve small changes to DNA such as base-pair substitutions, while somatic mutations usually involve large deletions.
B) Germ-line mutations occur during DNA replication, while somatic mutations do not.
C) Germ-line mutations can be passed on to offspring, while somatic mutations cannot.
D) Germ-line mutations are reversible, while somatic mutations are not.
E) Germ-line mutations result in cancers, while somatic mutations do not.

Question 18

Which of the following base changes in DNA is an example of a transition?

A) A to C
B) G to C
C) C to A
D) A to G
E) A to T

Question 19

Suppose a research study shows that people who suffer from severe depression are homozygous for a mutation in the hypothetical DEP gene. Individuals without this form of depression have the following sequence at the beginning of the translated region of their DEP genes: 5'-ATG ACG TTT GAA ATT CAG TCT AGA-3' (Met Thr Phe Glu Ile Gln Ser Arg). Affected individuals have the following sequence: 5'-ATG ACG TTT GAA ATT TAG TCT AGA-3'(Met Thr Phe Glu Ile STOP). The mutation identified is most likely a:

A) missense mutation.
B) gain-of-function mutation.
C) nonsense mutatio
D) frameshift mutatio
E) deletio

Question 20

Which of the following statements CORRECTLY describes nonsense mutations?

A) They cause a nonfunctional amino acid to replace a functional amino acid.
B) They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein.
C) They result in the insertion or deletion of a small number of nucleotides to the DNA.
D) They convert a codon for a particular amino acid within a gene into a stop codon.
E) They cannot revert to wild type.

Question 21

A codon that specifies the amino acid Ile undergoes a single-base substitution to become the amino acid Met. Which of the following describes the type of mutation that must have occurred?

A) a transition mutation at the first position of the codon
B) a transversion mutation at the first position of the codon
C) a transition mutation at the third position of the codon
D) a transversion mutation at the third position of the codon
E) a transition mutation or a transversion mutation at the third position of the codon

Question 22

Reversions, or reverse mutations (i.e., mutations that restore the wild-type phenotype initially lost by an earlier mutation), can be either of two types: back mutations or suppressor mutations. Explain how you could distinguish between these two different types of reversions using a test cross.

Question 23

A DNA sequence encodes a protein with the amino acid sequence Met-Leu-Ser-Ile-Met-Ala. A mutation occurs in the DNA sequence so that now it encodes a protein with the amino acid sequence Met-Leu-Val.
a. Propose an explanation for the type of mutation that produces the new amino acid sequence.
b. Give an example of a second mutation that would produce the following amino acid sequence: Met-Leu-Val-Ile-Met-Ala.

Question 24

How do intergenic and intragenic suppressor mutations differ?

Question 25

What is the difference between a missense mutation and a nonsense mutation?

Question 26

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Thr-Gly-Thr-Ile-Thr. Which describes the MOST likely type of mutation that occurred?

A) nonsense mutation
B) missense mutation
C) frameshift mutation
D) in-frame mutation
E) neutral mutation

Question 27

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?

A) transition mutation
B) transversion mutation
C) translesion mutation
D) nucleotide deletion
E) strand slippage

Question 28

The following sequence represents the DNA template strand of a gene:

Question 29

How do mutation rates differ among eukaryotic and prokaryotic organisms? What factors affect mutation rates?

Question 30

Tumor suppressor proteins can assist in slowing down the cell cycle under appropriate conditions. In humans, the TP53 gene encodes a tumor suppressor called p53. Most mutations in the TP53 gene result in a mutant form of p53 that can no longer function to slow down the cell cycle, which can lead to a cell becoming cancerous. However, some mutant forms of p53 actually possess the ability to increase a cell's resistance to anticancer treatments. Which of the following BEST describes this type of mutation?

A) loss-of-function mutation
B) gain-of-function mutation
C) reverse mutation
D) suppressor mutation
E) neutral mutation

Question 31

A diploid fungal cell is homozygous for a (TTG)₅ trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.)
ATGTTGTTGTTGTTGTTGTGA

Question 32

Explain how an individual with a suppressor mutation can be a double mutant but express a near normal phenotype.

Question 33

Helen has type I osteogenesis imperfecta (OI), a genetic skeletal disorder. Shown below is her DNA sequence for a portion of the coding region of the collagen type I gene, which contains the mutation responsible for her disorder. The corresponding wild-type sequence is shown also (only one DNA strand is shown in each case). What type of mutation does Helen carry?

A) missense
B) nonsense
C) silent
D) deletion
E) frameshift

Question 34

List all single-base substitutions that would change a codon for Leu to a nonsense codon (see Figure 15.12). For each, indicate whether it would be a transition or transversion.

Question 35

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?

A) nonsense mutation
B) missense mutation
C) frameshift mutation
D) in-frame mutation
E) neutral mutation

Question 36

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Question 37

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala. Which describes the MOST likely type of mutation that occurred?

A) nonsense mutation
B) missense mutation
C) frameshift mutation
D) in-frame mutation
E) neutral mutation

Question 38

What are the differences between neutral mutations and silent mutations?

Question 39

A geneticist is studying a mutation in a population of turtles that causes their shells to become extremely brittle. She determines the mutation is caused by the loss of two nucleotides in the coding region of a gene. Upon studying the mutant protein that is produced, she observes that it is 312 amino acids in length, as compared to the normal protein that is 588 amino acids in length. This mutant protein can no longer carry out its normal function of assisting in the Difficultening of a turtle's shell. Which of the following could NOT describe this mutation?

A) deletion
B) loss-of-function mutation
C) transversion
D) frameshift mutation
E) nonsense mutation

Question 40

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.)

Question 41

What do alkylating agents do?

A) They cause pyrimidine dimers.
B) They add methyl or ethyl groups to bases.
C) They oxidize guanine.
D) They deaminate cytosine.
E) All of the answers are correct.

Question 42

Assume that you have discovered a new chemical mutagen that modifies guanine so that it mispairs with adenine when adenine is in the template DNA strand during DNA replication. However, this mispairing is limited to when the modified guanine is being added to the newly replicating DNA strand. When the modified guanine is in the template DNA strand, it always pairs normally with cytosine being added to the growing newly synthesized strand. What type of mutation would you predict would be caused by the new chemical mutagen?

A) A-to-G base substitutions
B) A-to-C base substitutions
C) A-to-T base substitutions
D) A-to-G and A-to-C base substitutions
E) G-to-T base substitutions

Question 43

A codon for the amino acid serine undergoes a transversion so that it now codes for threonine. A transversion at a different site in the same codon then suppresses the first mutation. Give the nucleotides in the original codon, the transition mutation, and the transversion suppressor. (Note: There are two possible answers.)

Question 44

How can spontaneous mutations arise?

Question 45

How will the result of strand slippage on the newly synthesized strand differ from the result of strand slippage on the template strand?

Question 46

To determine whether human exposure to radiation results in an increase in recessive mutations in the germ line, scientists can examine the sex ratio of children born to parents exposed to higher than normal radiation levels. Explain how and why the sex ratio might be affected by radiation exposure.

Question 47

Assume you are a geneticist and you're asked to examine the effects of a radiation leak that occurred at a facility in Iraq several years ago. How would you assess the level of mutations caused by this leak?

Question 48

What is the difference between a mutagen and a carcinogen?

Question 49

Explain how UV light induces mutations in E. coli.

Question 50

In the Ames test, what types of mutations are used to test for chemical mutagens?

A) his^- to his⁺ mutations
B) pro^- to pro⁺ mutations
C) pro⁺ to pro^- mutations
D) his⁺ to his^- mutations
E) trp⁺ to trp^- mutations

Question 51

Ultraviolet light causes what type of DNA lesion?

A) large deletions
B) deaminated cytosines
C) pyrimidine dimers
D) mismatched bases
E) depurinations

Question 52

Assume that during DNA replication in a bacterium a mistake is made and a G is inserted into the newly synthesized DNA strand opposite a T in the template DNA strand. If this mistake is not repaired before the next round of DNA replication, what mutation will eventually result?

A) A-to-G base substitution
B) A-to-C base substitution
C) A-to-T base substitution
D) G-to-A base substitution
E) C-to-A base substitution

Question 53

Which of the following transposable elements have indirect repeats at each end?

A) Ac in maize
B) Ty in yeast
C) copia in Drosophila
D) Alu in humans
E) All of the answers are correct.

Question 54

The following nucleotide sequence is found in a short stretch of DNA: 5ʹ TGCC 3ʹ
3ʹ ACGG 5ʹ
Suppose a depurination event occurred within the top strand. If this mutant strand were used as a template for replication, what is the MOST likely sequence of the newly synthesized strand?

A) 3ʹ AAGG 5ʹ
B) 3ʹ TACC 5ʹ
C) 3ʹ AGGG 5ʹ
D) 3ʹ TTCC 5ʹ
E) 3ʹ AGG 5ʹ

Question 55

Suppose that you identify a mutation in a gene caused by a single base substitution. Which of the following would be the BEST choice to use in an attempt to reverse this mutation?

A) UV light
B) ethidium bromide
C) hydroxylamine
D) acridine orange
E) EMS

Question 56

The mutagen EMS converts guanine (G) to O-6-ethylguanine (G*). O-6-ethylguanine (G*) forms base pairs with thymine (T) instead of cytosine (C). Suppose that exposure to EMS damages a DNA molecule as shown below: a. Diagram the steps required for the incorporated G* to induce a stably inherited mutation. Your diagram should include all necessary rounds of replication.
b. Characterize the mutation induced by EMS as a transition, transversion, or frameshift.

Question 57

A company has invented a new low-calorie sugar substitute and wants to determine if the substitute might be carcinogenic, so researchers use it in the Ames test. The results show no increase in mutant bacterial colonies. They then perform feeding experiments in laboratory rats and find a significant increase in the incidence of cancer. Offer an explanation for why the Ames test did not accurately predict the carcinogenic potential of the sugar substitute and suggest a solution to the problem.

Question 58

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Question 59

Which of the following mutagens is MOST likely to cause a frameshift mutation?

A) base analog
B) alkylating agent
C) intercalating agent
D) ionizing radiation
E) UV light

Question 60

A scientist discovers a mutant gene in which a nucleotide was deleted. Which of the following chemicals could potentially reverse this mutation?

A) ethidium bromide
B) hydroxylamine
C) 5-bromouracil
D) EMS
E) nitrous acid

Question 61

Which of the following characterizes the mode of transposition of retrotransposons?

A) It involves an RNA intermediate.
B) It involves the initial synthesis of transposase.
C) It involves the production of a protein repressor.
D) It only occurs in nondividing host genomes.
E) It requires inverted repeats at each end of the retrotransposon.

Question 62

Which of the following transposable elements are flanked by direct repeats of a short portion of the host genome?

A) Tn10
B) L1
C) Activator (Ac)
D) Alu
E) All of the answers are correct.

Question 63

Upon transposing to a new site, transposable elements:

A) add methyl groups to bases of the surrounding DNA.
B) delete about 100 base pairs of DNA on each side of them.
C) duplicate their transposase gene.
D) express a gene that confers sensitivity to some common antibiotics.
E) create a duplication of a target sequence on each side of them.

Question 64

Which of the following pairs of sequences would you expect to be found in the same transposable element?

A) inverted repeats and a gene for transposase
B) long terminal repeats and a gene for transposase
C) inverted repeats and a gene for reverse transcriptase
D) a gene for transposase and a gene for reverse transcriptase
E) both long terminal repeats and a gene for transposase and inverted repeats and a gene for reverse transcriptase

Question 65

Which of the following is the MOST common transposable element in humans?

A) copia
B) Alu
C) Ac
D) Ty
E) P

Question 66

Which of the following is required for an IS element in E. coli to be able to transpose?

A) a gene for reverse transcriptase and long terminal repeats
B) a gene for reverse transcriptase and inverted repeats
C) a gene for transposase and inverted repeats
D) a gene for transposase and long terminal repeats
E) a gene for DNA polymerase and long terminal repeats

Question 67

Transposition can involve exchange of DNA sequences and recombination, which often leads to DNA:

A) acetylation.
B) rearrangements.
C) condensation.
D) repair.
E) replication.

Question 68

Transposable elements are found:

A) mainly in higher plants.
B) mainly in animals, particularly in mammals.
C) mainly in eukaryotes.
D) mainly in prokaryotes.
E) in practically all organisms.

Question 69

Practically all transposable elements that have been studied are associated with which of the following?

A) indirect repeats at each end
B) a gene for transposase
C) a gene for reverse transcriptase
D) a gene for RNA polymerase
E) flanking direct repeats

Question 70

Bacterial insertion sequences encode which of the following gene products?

A) reverse transcriptase
B) DNA polymerase
C) transposase
D) repressor
E) insertase

Question 71

Explain how transposable elements might play a role in studying gene function.

Question 72

A transposable element is found to use RNA as an intermediate in transposition. On the basis of this information, which of the following would you expect to be CORRECT?

A) The transposable element also probably makes transposase.
B) The transposable element may encode a reverse transcriptase.
C) The transposable element is probably located in a bacterial genome.
D) The transposable element probably contains inverted repeats at each end.
E) The transposable element will not be able to transpose without a second copy also present in the genome.

Question 73

Composite transposons in bacteria are characterized by which of the following?

A) They are composites of Ac and Ds elements.
B) Each has the ability to transpose either by replicative transposition or nonreplicative transposition.
C) They contain all deleted transposase genes.
D) They contain more than one gene.
E) No correct answer is provided.

Question 74

Which of the following is characteristic of retrotransposons?

A) They use transposase to transpose to new sites.
B) They have inverted repeats at each of their ends.
C) They transpose through an RNA intermediate.
D) They make transposase.
E) They are found only in prokaryotes.

Question 75

Which of the following statements describes the possible parasitic nature of transposable elements?

A) Transposable elements can increase in number within genomes without providing an advantage to the host.
B) Transposable elements are collected within their genomes by host organisms so that the host will benefit but not the transposable elements.
C) Transposable elements will provide an evolutionary advantage to host organisms by transposing as often as possible.
D) Transposable elements will enhance their expression of transposase so that the hosts can evolve more quickly.
E) Transposable elements will add methyl groups to their own DNA to reduce their own rate of transposition.

Question 76

A new IS element is found in bacteria. Which of the following pairs of DNA sequences would MOST likely be found at each end of the IS element? (Only one of the two DNA strands is given.)

A) 5´-GAGACTCTAC-3´ and 5´-GAGACTCTAC-3´
B) 5´-GAGACTCTAC-3´ and 5´-CATCTCAGAG-3´
C) 5´-GAGACTCTAC-3´ and 5´-CTCTGAGATG-3´
D) 5´-GAGACTCTAC-3´ and 5´-GTAGAGTCTC-3´
E) 5´-GAGACTCTAC-3´ and 5´-CAGACTCTAG-3´

Question 77

Consider two theoretical transposable elements in yeast, A and B. Each contains an intron and each transposed to a new location in the yeast genome. Suppose you then examine the transposons for the presence of the intron. In the new locations, you find that A has no intron but B does. From these facts, what can you conclude about the mechanisms of transposition for the two transposable elements?

A) B probably makes a transposase.
B) A probably has inverted repeats at each end of the element.
C) B probably uses RNA as an intermediate in the transposition event.
D) B probably makes a reverse transcriptase.
E) A probably doesn't create a duplication of the host genome target sequence.

Question 78

Which of the following statements BEST describes the Activator (Ac) and Dissociation (Ds) transposable elements in maize (corn)?

A) Ac elements cannot transpose unless a Ds element is present.
B) Ac contains a functional transposase gene; Ds lacks a functional transposase gene.
C) Ds contains a functional transposase gene; Ac lacks a functional transposase gene.
D) Both Ac and Ds have functional transposase genes.
E) Neither Ac nor Ds contains functional transposase genes.

Question 79

It is estimated that transposable elements compose approximately what percent of the human genome?

A) <1%
B) 1%
C) 10%
D) 50%
E) 99%

Question 80

Hybrid dysgenesis in Drosophila occurs:

A) when a male and a female, each carrying a copia element, mate and produce offspring that have numerous mutations.
B) in the offspring of a cross between a male that carries a copia element and a female that carries a P element.
C) in the offspring of a cross between a male that carries a Ty element and a female that carries an Ac element.
D) in the offspring of a cross between a male that carries a P element and a female that does not carry a P element.
E) in the offspring of a cross between a male that carries an Alu element and a female that carries a Ty element.