Exam 18: Gene Mutations and Dna Repair

Suppose that you identify a mutation in a gene caused by a single base substitution. Which of the following would be the BEST choice to use in an attempt to reverse this mutation?

Which of the following pairs of DNA repair systems will repair pyrimidine dimers in E. coli?

Which of the following statements describes the possible parasitic nature of transposable elements?

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?

A scientist discovers a mutant gene in which a nucleotide was deleted. Which of the following chemicals could potentially reverse this mutation?

Which of the following transposable elements are flanked by direct repeats of a short portion of the host genome?

Ultraviolet light causes what type of DNA lesion?

Hybrid dysgenesis in Drosophila occurs:

A geneticist is studying a mutation in a population of turtles that causes their shells to become extremely brittle. She determines the mutation is caused by the loss of two nucleotides in the coding region of a gene. Upon studying the mutant protein that is produced, she observes that it is 312 amino acids in length, as compared to the normal protein that is 588 amino acids in length. This mutant protein can no longer carry out its normal function of assisting in the Difficultening of a turtle's shell. Which of the following could NOT describe this mutation?

The following sequence represents the DNA template strand of a gene: a. Give the sequence of the mRNA transcribed from this DNA strand and, using the genetic code provided in Figure 15.12, give the amino acid sequence of the protein it encodes. b. Give the amino acid sequence of the protein encoded by this sequence after the following mutations have occurred: - a transition at nucleotide #10 - a transition at nucleotide #12 - atransition at nucleotide #7 - an insertion of a "G" immediately following nucleotide #10

Most transposable elements are flanked by direct DNA repeats. What is the significance of these direct repeats?

Explain how transposable elements might play a role in studying gene function.

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg Mutant sequence: atg g tgtcctatgtgagttgcggctgttg Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg

A company has invented a new low-calorie sugar substitute and wants to determine if the substitute might be carcinogenic, so researchers use it in the Ames test. The results show no increase in mutant bacterial colonies. They then perform feeding experiments in laboratory rats and find a significant increase in the incidence of cancer. Offer an explanation for why the Ames test did not accurately predict the carcinogenic potential of the sugar substitute and suggest a solution to the problem.

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Upon transposing to a new site, transposable elements:

A codon for the amino acid serine undergoes a transversion so that it now codes for threonine. A transversion at a different site in the same codon then suppresses the first mutation. Give the nucleotides in the original codon, the transition mutation, and the transversion suppressor. (Note: There are two possible answers.)

What do alkylating agents do?