Deck 14: Rna Molecules and Rna Processing

Question 1

Which of the following elements would NOT be found in an mRNA molecule?

A) protein-coding region
B) 3' untranslated region
C) 5' untranslated region
D) promoter
E) start and stop codons

Answer 1

promoter

Question 2

Which of the following statements about ribosomes and ribosomal RNA is NOT true?

A) Ribosomes typically contain about 80% of the total cellular RNA.
B) Ribosomal RNA is processed in both prokaryotes and eukaryotes.
C) In eukaryotes, genes for rRNA are usually present within tandem repeats.
D) Each ribosomal RNA component is encoded by a separate gene.
E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the nucleus.

Answer 2

D

Question 3

How many introns are present on a gene that consists of four exons?

A) two
B) three
C) four
D) five
E) The number cannot be determined from the information provided.

Answer 3

B

Question 4

The spliceosome is a large, ribonucleoprotein complex located in the:

A) cytoplasm.
B) endoplasmic reticulum.
C) Golgi aparatus.
D) nucleus.
E) nucleolus.

Question 5

The information needed during RNA editing comes MOST directly from:

A) pre-mRNA.
B) mRNA.
C) rRNA.
D) tRNA.
E) guide RNA.

Question 6

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule?

A) start codon
B) promoter
C) exons
D) introns
E) stop codon

Question 7

Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing?

A) U1
B) U2
C) U5
D) U6
E) spliceosomal proteins

Question 8

Guide RNAs are needed in:

A) transcription.
B) translation.
C) RNA interference.
D) RNA editing.
E) RNA splicing.

Question 9

Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide.

A) transcription; translation
B) polyadenylation; RNA transport
C) DNA methylation; chromatin condensation
D) alternative processing; RNA editing
E) gene silencing; RNA interference

Question 10

Which of the following statements about group I and group II introns is NOT true?

A) Both group I and II introns form elaborate and characteristic secondary structures with loops.
B) The splicing mechanism of group II introns is similar to that of spliceosome-mediated nuclear pre-mRNA splicing.
C) The length of group I and group II introns is much longer than the exons within the structures.
D) Group I and group II introns are exclusively found in mitochondrial and chloroplast encoded genes.
E) Both group I and group II introns are both found in bacterial genes.

Question 11

The 5' and 3'untranslated regions (UTRs) of processed mRNA molecules are derived from:

A) exons.
B) introns.
C) promoters.
D) terminators.
E) the protein-coding region.

Question 12

Which of the following statements CORRECTLY describes the facts about introns and exons?

A) The number of introns is always less than the number of exons in a gene.
B) Introns are degraded in the cytoplasm.
C) All eukaryotic genes contain an intron.
D) Mitochondrial and chloroplast genes do not contain introns.
E) Introns do not contain sequence-specific information.

Question 13

Which mechanism allows for more than one polypeptide to be encoded by a single gene?

A) regulated transcription
B) RNA interference
C) alternative RNA processing
D) self-splicing of introns
E) RNA methylation

Question 14

Which mechanism allows for the production of polypeptides that are not entirely encoded by DNA?

A) regulated transcription
B) RNA interference
C) alternative RNA processing
D) RNA editing
E) colinearity

Question 15

Which of the following statements regarding gene structure is TRUE?

A) The amino acid sequence of a polypeptide can be precisely predicted by the nucleotide sequence of the gene that encodes it.
B) The number of introns found in organisms is species specific.
C) The number of exons and introns generally correlates to the complexity of the organisms.
D) Intron cleavage and exon splicing are both mediated exclusively by protein enzymes.
E) The number of exons is always less than the number of introns in a gene.

Question 16

Which of the following statements about bacterial mRNA transcripts is TRUE?

A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain untranslated regions.
B) The Shine-Dalgarno sequence associates with an RNA component in the small subunit of ribosomes.
C) Transcription and translation take place sequentially in bacterial cells.
D) Most of bacterial genes contain a large number of introns and small number of exons.
E) The 5' end and 3' end of mRNA transcripts are modified in bacteria.

Question 17

Which of the following phenomena is NOT affected by the presence of alternative splicing?

A) speciation
B) development
C) organismal complexity
D) tissue specificity
E) RNA interference

Question 18

The human gene encoding calcitonin contains six exons and five introns and is located on chromosome 11. The pre-mRNA transcript from this gene can generate either calcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner. Calcitonin produced from the thyroid gland is 32 amino acids long and functions to regulate the calcium while CGRP, which contains 37 amino acids, is produced by the brain cells and involved in transmission of pain. Which of the following processes makes production of two functionally and structurally different proteins from the same gene possible?

A) self-spicing introns
B) differential transcription
C) alternative replication
D) 5' capping and polyadenylation
E) alternative RNA processing

Question 19

Which of the following statements BEST explains why only pre-mRNA receives a 5'cap?

A) The enzyme that initiates the capping step is known to associate with RNA polymerase II, which generates pre-mRNAs.
B) Only pre-mRNAs contain proper sequences for the cap to be added on.
C) The tail of the pre-mRNA can recruit the right combination of enzymes for capping.
D) Nuclear pore complexes only recognize pre-mRNAs and allow them out to the cytoplasm for the capping process to begin.
E) rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in the cytoplasm.

Question 20

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT?

A) Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide.
B) The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide.
C) Colinearity generally holds true for the coding regions of prokaryotic viral genes.
D) The vast majority of eukaryotic genes follow the concept of colinearity.
E) The exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs).

Question 21

Below is a list of steps of eukaryotic pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Recognition and binding the 3' AAUAAA sequence by specific protein factors
2) Cleavage at the poly(A) site
3) Addition of the 5' cap
4) Export to the cytoplasm
5) Addition of the poly(A) tail

A) 3, 1, 2, 5, 4
B) 2, 3, 4, 5, 1
C) 4, 2, 3, 1, 5
D) 1, 3, 5, 4, 1
E) 5, 4, 1, 3, 2

Question 22

Given the figure below, within which of the following would the 5ʹ untranslated region be located?

A) promoter
B) exon 1
C) exon 4
D) intron 1
E) A 5ʹ untranslated region would not be present in this figure.

Question 23

A key modification in the 3' end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

A) The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail.
B) The poly(A) tail facilitates the attachment of the ribosome to the mRNA.
C) The poly(A) tail is important for proper nuclear export of the mRNA.
D) The poly(A) tail at the 3' end translates to a long stretch of repeated amino acids.
E) Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.

Question 24

What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron?

A) A shorter than normal protein would be produced.
B) Replication would be inhibited.
C) A longer than normal mRNA would be produced.
D) A longer than normal DNA would be produced.
E) Transcription would terminate prematurely.

Question 25

During the posttranscriptional processing of pre-mRNA, a 5' cap is added to an mRNA in step-by-step manner. Which of the following reasons prevents the 5'capping process, involving methylation, from occurring on a DNA strand?

A) lack of an OH group on the 2' carbon of the deoxyribose
B) lack of an OH group on the 3' carbon of the deoxyribose
C) lack of a uracil nitrogenous base on the DNA strand
D) lack of GTP hydrolysis associated with DNA transcription
E) lack of a H on the 4' carbon of the deoxyribose

Question 26

The calcitonin gene can encode either the hormone calcitonin or a protein called calcitonin-gene-related peptide depending on which 3' cleavage site is used. In the thyroid gland, cleavage and polyadenylation occur after the fourth exon leading to calcitonin production. However, in the brain, the exact same transcript is cleaved after the sixth exon yielding calcitonin-gene-related peptide. This is an example of:

A) multiple capping.
B) alternative RNA processing.
C) polyadenylation.
D) environmental influence.
E) mutation.

Question 27

Which of the following processes does NOT support the observation that the amino acid sequence of a protein may not be the same as that encoded by its gene?

A) RNA editing
B) alternative splicing
C) multiple 3' cleavage sites
D) 5' capping
E) errors that occurred during transcription

Question 28

The 5' cap on an mRNA is important for all the processes listed below except for the _____ of an mRNA molecule.

A) transcription
B) intron removal
C) stability
D) initiation of translation
E) ribosomal interaction

Question 29

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

A) 5' ACUGGACAGUCGGCACCACG 3'
B) 5' GUAAGAAUACAAC 3'
C) 5' UGACCUGUCAGCCGUGGUGC 3'
D) 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
E) 5'AGAAUACAACACAGUCGGCACCACG 3'

Question 30

Which of the following consensus sequences are NOT found in nuclear introns?

A) GU at the 5' splice site at the beginning of the intron
B) AG at the 3' splice site at the end of the intron
C) CCA at the 3' site downstream of the branch point
D) a at the lariat branch point site
E) 3' CAGG consensus sequence at the 3'splice site

Question 31

Given the figure below, within which of the following would the Shine-Dalgarno sequence be located?

A) promoter
B) exon 1
C) exon 4
D) intron 1
E) A 5ʹ untranslated region would not be present in this figure.

Question 32

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it.
B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site.
C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.
D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site.
E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

Question 33

Which of the following intron types is present only in eukaryotes?

A) nuclear pre-mRNA
B) group I intron
C) group II intron
D) tRNA
E) group III intron

Question 34

If a splice site were mutated so that splicing did not take place, what would be the effect on the amino acid sequence?

A) It would be shorter than normal.
B) It would be longer than normal.
C) It would be the same length but would encode a different protein.
D) It would be unable to fold into its correct structure.
E) It depends on the mutant mRNA sequence.

Question 35

During the posttranscriptional processing of pre-mRNA, a 5' cap is added to an mRNA. Arrange the following steps of the capping process in the CORRECT order. 1. Addition of a guanine nucleotide via a 5'-5' bond
2) Removal of a phosphate from a ribonucleotide triphosphate at the 5' head of the pre-mRNA
3) Methylation at the 2' position of the sugar in the second and the third nucleotides
4) Methylation at position 7 of the terminal guanine base

A) 1, 2, 3, 4
B) 2, 4, 1, 3
C) 4, 1, 3, 2
D) 2, 1, 4, 3
E) 3, 2, 4, 1

Question 36

Which of the following intron types requires spliceosomes for removal?

A) group I intron
B) group II intron
C) group III intron
D) nuclear pre-mRNA
E) tRNA

Question 37

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation?

A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly.
B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes.
C) The 5ʹ cap could assist in the identification of stop codons within the mRNA.
D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters.
E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA.

Question 38

Which of the following statements CORRECTLY describes the concept of alternative splicing?

A) Eukaryotic gene and protein sequences are precisely colinear.
B) With the rare exception of RNA editing, every nucleotide contained in a processed mRNA molecule is derived from exon sequences.
C) Every other intron is removed in an alternate manner to generate a functional mRNA transcript.
D) Only a subset of the same mRNA transcripts is specifically selected for splicing in the nucleus.
E) Multiple protein products are often produced from single eukaryotic genes.

Question 39

Below is a list of steps of intron removal and splicing during pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Attachment of snRNP U1 to the 5'splice site
2) Transcription of the DNA template into the pre-mRNA molecule
3) Release of lariat structure
4) Splicing together of exons
5) Transesterification reaction at the branch point adenine

A) 1, 2, 3, 4, 5
B) 4, 1, 3, 5, 2
C) 2, 1, 5, 3, 4
D) 3, 5, 1, 2, 4
E) 5, 3, 4, 1, 2

Question 40

What do group I and group II introns have in common?

A) Both are found in mitochondrial genes.
B) Both are found in bacteriophages.
C) Both are known to be self-splicing introns.
D) Both are found in protein-coding genes of chloroplasts.
E) Both are frequently found in eukaryotic genes.

Question 41

Describe the evidence that suggested that RNA was the carrier of genetic information from the nucleus to the ribosome.

Question 42

Anticodons are found in _____ molecules.

A) mRNA
B) tRNA
C) rRNA
D) snRNA
E) miRNA

Question 43

Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided.
b. Predict what would happen if the G in the 5' splice site were mutated to a C.
c. We learned in this chapter that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation? How can you experimentally demonstrate that a 5' cap is important for this process?

Question 44

What is an snRNP and what role does it play in the cell?

Question 45

Which of the following nitrogenous bases is frequently modified enzymatically to become a rare type of nitrogenous base in tRNA?

A) adenine
B) uracil
C) thymine
D) cytosine
E) guanine

Question 46

Critique the idea that the information needed to encode a particular polypeptide always resides within a single gene.

Question 47

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA?

A) The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA production.
B) The CFTR gene likely has many introns that are excised prior to translation of the CFTR protein.
C) The 5ʹ cap and the poly(A) tail get removed prior to translation of the CFTR protein.
D) Methylation of the 5ʹ cap silences portions of the gene, preventing those regions from being transcribed into mRNA.
E) The mutation that causes cystic fibrosis creates a new terminator sequence, resulting in a shorter mRNA.

Question 48

Devise a strategy to prove that splicing occurs in the nucleus.

Question 49

For a time, a gene was defined as a sequence of DNA that encodes a polypeptide. Critique this outdated notion of what a gene is and propose a more comprehensive definition.

Question 50

What are guide RNAs (gRNAs) and what do they do?

Question 51

Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ cap. What would be an expected result?

A) Transcription would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript.
B) Translation would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript.
C) Transcription would not occur as the transcription factors would not be able to bind to the promoter.
D) Translation would not occur as the ribosome would not be able to bind to the mRNA.
E) Replication would not occur as DNA polymerase would not be able to bind to the DNA at the origin of replication.

Question 52

In your own words, list a comprehensive definition for "gene" at the molecular level.

Question 53

What is a pulse-chase experiment? Explain how this technique can be used to follow the products of a short-term event.

Question 54

To which part on a tRNA would an amino acid attach during tRNA charging?

A) 3' acceptor arm
B) anticodon arm
C) T $\Psi$ C arm
D) DHU arm
E) extra arm

Question 55

Draw the tRNA cloverleaf secondary structure, labeling the various loops and stems. Indicate the functions of the acceptor stem and the anticodon. How are modified bases produced in tRNAs?

Question 56

When studying a plant's protein production, a scientist found two different proteins. The first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one only contained amino acids from exons from 1, 2, and 3. Which of the following is MOST likely responsible for this difference?

A) a mutation in the gene that encodes an miRNA
B) posttranslational modification
C) RNA editing
D) alternative RNA processing
E) a mutation in the gene that encodes a snoRNA

Question 57

Explain how RNA editing violates a general principle of molecular genetics.

Question 58

Devise and describe a strategy to conduct a pulse-chase experiment to determine if newly transcribed eukaryotic RNA actually moves from the nucleus to the cytoplasm.

Question 59

Which of the following observations supports the notion that the gene is simply a set of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide?

A) Alternative splicing-a single gene can yield multiple mRNA and protein products.
B) A single ribosomal RNA transcript can liberate several RNA molecules via further processing.
C) RNAs can be the functional product of a gene without being translated into a protein product.
D) Within a protein coding region, each codon represents a specific amino acid that will be linked to form a polypeptide.
E) Regulatory elements are part of a gene that regulate timing, degree, and specificity of gene expression but are not transcribed.

Question 60

Suppose an organism ingests a drug that disassembles its spliceosomes, rendering them nonfunctional. Which of the following would be seen MOST immediately in this organism?

A) All translation would stop.
B) tRNA bases would no longer be modified into rare bases.
C) Introns would not be removed from the pre-mRNA.
D) mRNA would not be able to bind the 5ʹ cap.
E) rRNA would no longer be appropriately processed.

Question 61

Discuss the features of C. elegans that make it an important model system for studies of animal genetics and development. Include in your answer some unique features of C. elegans compared to other model systems.

Question 62

Below is a list of steps in the processing of ribosomal RNAs. Please select the choice that lists the steps in the CORRECT sequential order. 1. Methyl groups added to specific bases and the 2'-carbon atom of some ribose sugars
2) Transcription of the rRNA precursors from DNA
3) Cleavage of precursor rRNA
4) Individual rRNA molecules ready for ribosome assembly
5) Trimming of precursor rRNA

A) 3, 1, 2, 5, 4
B) 2, 3, 4, 5, 1
C) 4, 2, 3, 1, 5
D) 1, 3, 5, 4, 1
E) 2, 1, 3, 5, 4

Question 63

siRNAs and miRNAs function in which of the following processes?

A) transcription
B) translation
C) RNA interference
D) RNA editing
E) RNA splicing

Question 64

A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic cell, she inserts an miRNA that is complementary to a portion of the XYZ mRNA found in the cell. What result would you predict?

A) There will be an increase in the amount of XYZ protein made.
B) There will be a decrease in the amount of XYZ protein made.
C) There will be an increase in the transcription of the XYZ gene.
D) There will be a decrease in the transcription of the XYZ gene.
E) No change will result from the insertion of the miRNA.

Question 65

Compare and contrast the mechanisms of splicing for nuclear pre-mRNA introns, group I introns, group II introns, and tRNA introns.

Question 66

Which of the following regulatory RNA types is different from the rest in terms of its length?

A) siRNA
B) crRNA
C) miRNA
D) piRNA
E) lncRNA

Question 67

Which class of RNA is MOST abundant in cells?

A) mRNA
B) tRNA
C) rRNA
D) snRNA
E) miRNA

Question 68

Which of the following small RNA types is unique to prokaryotes?

A) siRNA
B) crRNA
C) miRNA
D) piRNA
E) lncRNA

Question 69

What is the similarity between miRNAs, siRNAs, and piRNAs?

A) All three types originate from transposons or viruses and are found in all organisms.
B) They all target and degrade the gene from which they were transcribed.
C) All three are generated from a single-stranded RNA that gets cleaved.
D) All three can influence chromatin structure, which, in turn, can influence gene expression.
E) All three associate with Piwi proteins in order to mediate RNA degradation.

Question 70

A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process?

A) RNA splicing of pre-mRNA
B) translation
C) assembly of the nucleosome
D) replication
E) transcription

Question 71

Which of the following classes of RNAs is unique to eukaryotes?

A) messenger RNA (mRNA)
B) ribosomal RNA (rRNA)
C) transfer RNA (tRNA)
D) small nuclear RNAs (snRNAs)
E) CRISPR RNAs (crRNAs)

Question 72

Which of the following rRNA components originates from a separate gene transcript rather than as a cleaved product of a long single precursor rRNA transcript?

A) prokaryotic 16S rRNA
B) prokaryotic 23S rRNA
C) eukaryotic 18S rRNA
D) eukaryotic 5.8S rRNA
E) eukaryotic 5S rRNA

Question 73

A scientist is studying a gene known as the ABC gene in bacteria. Into a bacterial cell, she inserts an miRNA that is complementary to a portion of the ABC mRNA found in the cell. What result would you predict?

A) There will be an increase in the amount of ABC protein made.
B) There will be a decrease in the amount of ABC protein made.
C) There will be an increase in the transcription of the ABC gene.
D) There will be a decrease in the transcription of the ABC gene.
E) No change will result from the insertion of the miRNA.

Question 74

What attributes make miRNA a potent agent for silencing gene expression by allowing it to silence a large number of genes simultaneously?

Question 75

A microbiologist isolated a mutant strain of E. coli that is extremely susceptible to bacteriophage infection, by a wide range of bacteriophages. Which of the following genes might she explore as a possible site of the mutation that results in this phenotype?

A) A gene that encodes a small nucleolar RNA
B) A gene that encodes a Cas protein
C) A gene that encodes a Piwi-interacting RNA
D) A gene that encodes either a miRNA or a siRNA
E) A gene that encodes an immune RNA