Deck 15: The Genetic Code and Translation

Question 1

There are _____ different codons, which encode 20 amino acids and 3 stop codons.

A) 16
B) 20
C) 23
D) 61
E) 64

Answer 1

E

Question 2

The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to encode each amino acid?

Answer 2

not answered

Question 3

Which one of the following codons codes for a different amino acid from the rest?

A) CUU
B) CUC
C) UUA
D) UUU
E) CUA

Answer 3

D

Question 4

The genetic code is said to be "degenerate" because:

A) there are more codons than amino acids.
B) there are more amino acids than codons.
C) different organisms use different codons to encode the same amino acid.
D) some codons specify more than one amino acid.
E) there are more tRNAs than amino acids.

Question 5

Which of the following statements describes the "wobble" rules CORRECTLY?

A) There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids.
B) The number of the genetic code exceeds the number of amino acids available in the cell.
C) There are multiple tRNAs that may bind to the same amino acids.
D) There are multiple codons that may code for the same amino acids.
E) The third base pairing between the tRNA and mRNA is relaxed.

Question 6

The genetic code is NOT universal for:

A) prokaryotes, which use a different genetic code than eukaryotes.
B) a few mitochondrial genes, which substitute one sense codon for another.
C) viruses, which use an entirely different genetic code.
D) archaebacteria, which have their own genetic code.
E) animal species whose cells are more advanced and complex.

Question 7

Which of the following is observed in prokaryotes but not in eukaryotes?

A) UGG is an example of a stop codon only found in prokaryotes.
B) An mRNA can be translated by only one ribosome at a time in prokaryotes.
C) The 5´ end of a prokaryotic mRNA can be translated while the 3´ end is still being transcribed.
D) Translation does not require any protein factors in prokaryotes.
E) In prokaryotes, ribosomes move along an mRNA in the 3´ to 5´ direction.

Question 8

The amino acid sequence of a polypeptide is referred to as the _____ sequence of the polypeptide.

A) primary
B) secondary
C) tertiary
D) quaternary

Question 9

What was the key technical deficiency that prevented Nirenberg and colleagues from deciphering the genetic code? What were the two important breakthroughs that still allowed them to break the genetic code?

Question 10

Which of the following statements about the formation of the peptide bond between amino acids is INCORRECT?

A) The formation of peptide bonds results in the formation of a water molecule.
B) The amino group of the first amino acid and the carboxyl group of the second amino acid are involved in forming a peptide bond.
C) The carboxyl group of the first amino acid reacts with the amino group of the second amino group to form a peptide bond.
D) A polypeptide formed by a series of peptide bonds will result in two distinct free ends, one with a free amino group and the other with a free carboxyl group.
E) The number of peptide bonds formed in a polypeptide varies from protein to protein.

Question 11

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

A) The result would be no change in the protein, since deletions are very rare.
B) A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal.
C) Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made.
D) Since exons are not coding regions, no changes in the protein would occur.
E) No change in the reading frame would occur due to the degeneracy of the genetic code.

Question 12

Which amino acid is coded by the stop codons in most organisms?

A) met
B) pro
C) trp
D) cys
E) none

Question 13

Which of the following statements about proteins is INCORRECT?

A) All proteins are made up of some combination of 20 essential amino acids.
B) Like nucleic acids, polypeptides have polarity.
C) A single polypeptide has primary, secondary, and tertiary structures.
D) $\alpha$ -helix and $\beta$ -pleated sheets do not require a specific sequence of amino acids to form.
E) Some proteins contain more than one polypeptide chain.

Question 14

Codons that specify the same amino acid are said to be:

A) wobbly.
B) isoaccepting.
C) hypothetical.
D) synonymous.
E) anonymous.

Question 15

The antibiotic streptomycin binds to the 30S subunit in bacteria and interferes with translation. Streptomycin resistance (SmR) can occur through mutation in the rpsL gene, which encodes the ribosomal protein S12. The antibiotic can no longer bind to the altered protein, so translation can occur without interference from the antibiotic. However, in the absence of streptomycin, many SmR strains of bacteria grow less well than the non-mutant streptomycin-sensitive (SmS) bacteria.
a. Propose a model for why SmR bacteria grow better than SmS bacteria in the presence of streptomycin but not as well in the absence of streptomycin.
b. During translation, an incorrect amino acid is occasionally incorporated into the polypeptide chain-that is, the amino acid added does not correspond to the codon at that location in the mRNA. You develop an assay that can assess this rate of incorrect amino acid incorporation and thereby estimate the accuracy of translation in bacteria. You find that SmR bacteria are more accurate than SmS bacteria in this experiment. How might this observation affect your model above?

Question 16

What was Beadle and Tatum's definition of a gene? Give a modern definition and explain how it differs from that of Beadle and Tatum.

Question 17

Four different uracil auxotrophs of Neurospora, a eukaryotic mold, are tested for growth on uracil and uracil precursors. The data are shown in the following table. A plus sign (+) means growth. $\quad\quad\quad\quad\quad\quad\quad { \text { Compound } }$
$\begin{array} { | l | l | l | l | l | l } \hline & \text { A } & \text { B } & \text { C } & \text { D } & \text { Uracil } \\\hline \text { Mutant 1 } & + & + & + & - & + \\\hline \text { Mutant 2 } & - & - & + & - & + \\\text { Mutant 3 } & + & - & + & - & + \\\text { Mutant 4 } & - & - & - & - & + \\\hline\end{array}$

-Neurospora can be grown as haploids or diploids. Haploid mutants 1 and 2 are fused to make a diploid. If both 1 and 2 carry recessive mutations, on which compounds will the diploid be able to grow?

Question 18

Four different uracil auxotrophs of Neurospora, a eukaryotic mold, are tested for growth on uracil and uracil precursors. The data are shown in the following table. A plus sign (+) means growth. $\quad\quad\quad\quad\quad\quad\quad { \text { Compound } }$

$\begin{array} { | l | l | l | l | l | l } \hline & \text { A } & \text { B } & \text { C } & \text { D } & \text { Uracil } \\\hline \text { Mutant 1 } & + & + & + & - & + \\\hline \text { Mutant 2 } & - & - & + & - & + \\\text { Mutant 3 } & + & - & + & - & + \\\text { Mutant 4 } & - & - & - & - & + \\\hline\end{array}$

-
Diagram the uracil pathway, showing the step at which each mutant is blocked.

Question 19

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing.

A) 5'base
B) middle base
C) 3' base

Question 20

For any sequence of nucleotides, how many reading frames are possible?

A) 1
B) 2
C) 3
D) 5
E) 10

Question 21

During initiation, the _____ subunit is the first part of the ribosome to associate with the mRNA.

A) small
B) large
C) intermediary
D) secondary
E) tertiary

Question 22

A bacterial protein is encoded by the following mRNA sequence: 5'-AUGGUGCUCAUGCCCTAA-3'. The second methionine codon (AUG) in this mRNA sequence will:

A) serve as the initiation codon.
B) encode N-formylmethionine.
C) encode methionine that will eventually be removed.
D) encode unformylated methionine.
E) be skipped as the translation progresses.

Question 23

You identify a novel deep-sea vent (DSV) bacteria and wish to explore its molecular biology. You find that you can introduce DNA sequences into the bacteria and it will transcribe and translate those sequences. However, you notice some curious differences between the expected proteins and the actual proteins produced.
a. A 9-bp DNA sequence that in E. coli encodes a short peptide of Met-Trp-Phe instead produces a peptide of Met-Cys-Val-Trp-Gly-Val-Phe in the DSV bacteria. What is the sequence of the coding strand of the short DNA fragment? Propose an explanation for the longer peptide produced by the DSV bacteria.
b. Curiously, a 9-bp sequence that in E. coli produces a peptide of Met-Thr-Asn does not produce any peptide in the DSV bacteria. What is the sequence of the coding strand of this DNA fragment? Propose an explanation for the absence of any peptide.

Question 24

Which of the following does NOT enhance the binding of the ribosome to the 5´ end of the mRNA?

A) 5´ cap
B) 3´ poly(A) tail
C) cap-binding proteins
D) poly(A) proteins
E) enhancer

Question 25

A random sequence of synthetic RNA is made using equal proportions of A and C. When it is translated, which amino acids will be incorporated into the protein?

Question 26

Translating an mRNA requires two other types of RNA:

A) tRNA and mRNA.
B) tRNA and miRNA.
C) tRNA and rRNA.
D) rRNA and siRNA.
E) snRNA and snoRNA.

Question 27

Use the following to answer questions :
After the peptide bond forms, what will happen next?

A) tRNA A will be carrying the polypeptide and it will shift to the P site.
B) tRNA A will be carrying the polypeptide and it will shift to the A site.
C) tRNA B will be carrying the polypeptide and it will shift to the P site.
D) tRNA B will be carrying the polypeptide and it will shift to the A site.
E) Ribosome disassembles to release the tRNAs and to allow new tRNA to enter.

Question 28

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

Question 29

Use the following to answer questions

-If the bottom strand of the DNA is the template, the tRNA anticodon sequence for the first RNA codon, left to right or 5' to 3', is:

A) GGA.
B) AUG.
C) CAC.
D) UCC.
E) CCU.

Question 30

What is the function of peptidyl transferase activity?

A) It charges tRNAs.
B) It acetylates the end of a protein after translation.
C) It cleaves the polypeptide from the last tRNA during termination.
D) It moves ribosomes along mRNA during translation.
E) It forms peptide bonds.

Question 31

During initiation of translation:

A) the initiator tRNAmet binds to the A site of a ribosome.
B) specific rRNA base pairs with a sequence in mRNA to position a ribosome at the start codon.
C) IF-3 must be recruited to the 30S ribosome in order for the 70S initiation complex to assemble.
D) there is no energy expenditure as the tRNA binding to mRNA is via complementary base pairing.
E) both 70S and 30S ribosome subunits must simultaneously recognize an mRNA to bind.

Question 32

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it?

A) 5' AUG 3'
B) 5' GUA 3'
C) 5' ATC 3'
D) 5' CTA 3'
E) 5' CAU 3'

Question 33

Which of the following is NOT required during the process of tRNA charging?

A) amino acid
B) tRNA
C) GTP
D) ATP
E) aminoacyl-tRNA synthetase

Question 34

The function of aminoacyl-tRNA synthetases is to:

A) transcribe tRNA genes.
B) match tRNA anticodons and mRNA codons at the ribosome.
C) attach appropriate amino acids to corresponding tRNAs.
D) form the peptide bond between amino acids at the ribosome.
E) synthesize and transport amino acids to the ribosomes.

Question 35

Use the following to answer questions :
The next step in the translation of this mRNA will be the formation of a peptide bond between which two of the numbered amino acids?

A) amino acid 2 and amino acid 3
B) amino acid 2 and amino acid 4
C) amino acid 1 and amino acid 3
D) amino acid 1 and amino acid 2
E) amino acid 3 and amino acid 4

Question 36

A tRNA anticodon is 5' GCU 3'. What amino acid does it carry?

A) ala
B) arg
C) ser
D) pro
E) thr

Question 37

Use the following to answer questions
If the bottom strand of the DNA serves as the template, the amino acid sequence of the protein produced from the RNA would be:

A) met-leu-ser.
B) arg-val-his.
C) thr-ile-phe.
D) pro-gly-trp.
E) lys-val-his.

Question 38

Use the following to answer questions

-If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

A) AUAGGCAGU.
B) UCCCAGGUG.
C) CACCUGGGA.
D) AGGGUCCAC.
E) GACAUUAGA.

Question 39

What is the minimum number of different aminoacyl-tRNA synthetases required by a cell?

A) 64, one for each codon
B) 61, one for each sense codon
C) 30, one for each different tRNA
D) 50, one for each different tRNA
E) 20, one for each amino acid

Question 40

Use the following to answer questions
Process 2, illustrated above, represents:

A) replication.
B) transcription.
C) translation.
D) RNA processing.
E) RNA interference.

Question 41

Use the following to answer questions
Refer to the following sequence:
5' ...GGAGCUCGUUGUAUU... 3'

-This sequence is RNA because:

A) it is single stranded.
B) it contains U (uracil) and no T (thymine).
C) it runs in a 5'to 3'direction.
D) it codes for amino acids .
E) it is a small molecule.

Question 42

The wild-type sequence of a protein is ... asp-ile-cys-trp.… The sequence of a mutant form of the protein is ... asp-ile-tyr-trp.... Write all possible DNA sequences for the wild-type and mutant alleles of the gene for this protein; underline the changed nucleotide in the mutant allele.

Question 43

Use the following to answer questions
Refer to the following sequence:
5' ...GGAGCUCGUUGUAUU... 3'

-The sequence 5' ...GGAGCUCGUUGUAUU... 3'is changed to 5'… GGAGACUCGUUGUAUU… 3'. What would be the effect on the amino acid sequence?

A) There would be no effect on the amino acid sequence.
B) This is an insertion mutation so there would be a premature stop codon.
C) The amino acid sequence would be asn-thr-thr-thr-leu.
D) The amino acid sequence would be thr-ser-tyr-leu-asn.
E) The amino acid sequence would be gly-asp-ser-leu-tyr.

Question 44

An mRNA has the stop codon 5' UAA 3'. What tRNA anticodon will bind to it?

A) 5' ATT 3'
B) 5' AUC 3'
C) 5' ACU 3'
D) 5' UUA 3'
E) none

Question 45

Which of the following statements does NOT describe the events in prokaryotic translation elongation?

A) The nucleotides in the Shine-Dalgarno sequence of the mRNA pair with their complementary nucleotides in the 16S rRNA.
B) A ribosome with a growing peptide attached to a tRNA in the P site accepts a charged tRNA with the next amino acid into the A site. The charged tRNA enters as a complex with EF-Tu and GTP.
C) If the anticodon of the charged tRNA matches the codon, GTP is cleaved and EF-Tu exits and is regenerated to EF-Tu-GTP by EF-Ts.
D) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site.
E) The ribosome translocates toward the 3' end of the mRNA with the aid of EF-G and GTP hydrolysis. The empty tRNA that was in the P site moves to the E site and exits. The tRNA with the polypeptide that was in the A site moves to the P site.

Question 46

Use the following to answer questions
An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

-How does this mutation change the mRNA?

A) The third codon in the mRNA is changed from AAG (lysine) to UAG (stop).
B) The third codon in the mRNA is changed from GCA (alanine) to GCU (alanine).
C) The third codon in the mRNA is changed from CAA (glutamine) to CUA (leucine).
D) The third codon in the mRNA is changed from CGU (arginine) to CGA (arginine).
E) There is no change in the mRNA.

Question 47

Prokaryotic ribosomes are inhibited by antibiotics like tetracyclines. As eukaryotes, humans are unaffected by these antibiotics. However, ribosomes within human mitochondria more closely resemble prokaryotic ribosomes than eukaryotic ribosomes. Why aren't tetracyclines more toxic to humans if they can, in theory, inhibit mitochondrial ribosomes?

Question 48

Which of the following events is NOT part of prokaryotic translation initiation?

A) IF-3 separates ribosome subunits so that a small subunit can bind mRNA through base pairing of the 16S rRNA and the Shine-Dalgarno sequence on the mRNA.
B) An initiator tRNA^formylmet binds the initiation codon, with the help of IF-1 and IF-2 complexed with GTP. The tRNA^formylmet is positioned in the P site.
C) A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site.
D) IF-3 dissociates, allowing a large subunit to bind the 30S initiation complex.

Question 49

Use the following to answer questions
Refer to the following sequence:
5' ...GGAGCUCGUUGUAUU... 3'

-Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end?

A) gly-ala-arg-cys-ile...
B) pro-arg-ala-thr-stop
C) met-asn-glu-leu…
D) glu-leu-val-val-phe…
E) leu-glu-gln-his-asn…

Question 50

Use the following to answer questions
An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

-E. coli strains that have both the original ade1^- mutant allele shown above and a mutant allele for a gene that encodes a lysine tRNA are able to make some normal ade1 enzyme. The mutant lysine tRNA allele makes a tRNA that has one base that is different from the wild-type tRNA. Which of the following statements would help explain how the lysine tRNA mutation allows synthesis of the normal ade1 enzyme? (Select all that apply.)

A) The mutation in the lysine tRNA gene changes the sequence of the anticodon.
B) The mutant tRNA pairs with UAG, a stop codon.
C) When the mRNA from the ade1^- allele is being translated, a mutant tRNA^lysine could incorporate a lysine into the protein, bypassing the mutant UAG.
D) The ade1^- mutant would always result in a stop signal regardless of the mutant tRNA.
E) The mutant tRNA would always match with UAG and prevent normal termination of the polypeptide chain.

Question 51

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy?

A) The DNA sequence change occurred in a synonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered.
B) If the protein sequence was not affected, no lethal phenotype manifested.
C) The DNA sequence change resulted in an amino acid change, but that amino acid change had no negative effect on protein function (i.e., was a neutral change).
D) The DNA sequence change occurred in a nonsynonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered.
E) All mutations that cause a change in DNA sequence result in a lethal phenotype.

Question 52

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.

Question 53

Describe the events in prokaryotic translation elongation.

Question 54

List three differences between prokaryotic and eukaryotic translation.

Question 55

Use the following to answer questions
An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

-How does the mutation affect the enzyme?

A) The protein won't be synthesized and translation will stop at the third codon.
B) The protein will not be changed because the mutation did not change the amino acid.
C) The protein will be changed because the mutation altered the amino acid.
D) The protein will not be changed because the mRNA was not changed.

Question 56

Describe the events in prokaryotic translation initiation.

Question 57

E. coli only has a single tryptophan tRNA gene. Why, given this arrangement, might it be difficult to identify mutants that alter the anticodon of this tRNA gene?

Question 58

Use the following to answer questions
Refer to the following sequence:
5' ...GGAGCUCGUUGUAUU... 3'

-The nucleotide sequence 5'...GGAGCUCGUUGUAUU... 3' is changed to 5'GGAGACUCGUUGUAUU 3'. Why does or why doesn't the amino acid sequence change?

A) The reading frame changes after the mutation (the addition of an A in the fifth position) and so the amino acid sequence is modified after that point.
B) The reading frame, starting at the 5' end of this sequence, would be modified because of this change and so the entire amino acid would be different.
C) The amino acid is not changed since the coding sequence was not changed at the 5' position.
D) A premature stop codon caused by this change would result in a truncated polypeptide.
E) Just one amino acid would be changed in the resulting polypeptide.

Question 59

Use the following to answer questions
An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

-E. coli strains that have both the original ade1^- mutant allele shown above and a mutant allele for a gene that encodes a lysine tRNA are able to make some normal ade1 enzyme. The mutant lysine tRNA allele makes a tRNA that has one base that is different from the wild-type tRNA. Why might the mutant lysine tRNA allele affect overall cell growth?

A) The mutant tRNA^lysine will occasionally cause translation to continue beyond the normal stop codon on mRNAs that normally use UAG as a stop codon.
B) The premature stop codon from the ade1^- allele will always cause shortened proteins.
C) The mutant tRNA will prevent the translational machinery from recognizing the normal stop codon on the mRNA and so will result in incorrect proteins.
D) The mutant tRNA^lysine will recognize the stop codon on the mutant ade1^- allele and cause the protein to be terminated.
E) The mutant tRNA^lysine will incorporate a lysine at every UAG stop codon.

Question 60

Which of the following mRNA codons will bind to the tRNA anticodon 5' GCU 3', considering wobble-base pairing rules.

A) 5' AGU 3' and 5' AGC 3'
B) 5' UGA 3' and 5' CGA 3'
C) 5' AGC 3'
D) 5' CGA 3'
E) 5'AGU 3', 5' AGC 3', 5' AGA 3', and 5' AGG 3'

Question 61

Which of the following mechanisms specifically allows detection and rapid degradation of mRNA containing a premature termination codon?

A) RNA interference
B) no-go decay
C) nonsense-mediated mRNA decay
D) transfer-messenger RNA mediated ribosomal removal
E) nonstop mRNA decay

Question 62

During elongation, an incoming charged tRNA enters at the _____ site of the ribosome.

A) peptidyl (P)
B) aminoacyl (A)
C) exit (E)
D) Shine-Dalgarno
E) Kozak

Question 63

Although the genetic code is nearly universal, some variations do exist. In vertebrate mitochondria, UGA codes for Trp (instead of termination), AUA codes for Met (instead of Ile), and AGA and AGG are stop codons (instead of coding for Arg). Translate the following coding strand DNA sequences using both the standard code and the vertebrate mitochondrial code.
a. 5' ATGGCCATAAGATGA 3'
b. 5' ATGGGGGATCGCTAA 3'
c. 5' ATGTGATGGCATCTTATAAATTGATAA 3'

Question 64

An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

- How does this mutation change the mRNA, and how does it affect the enzyme?

Question 65

Is the following sequence RNA or DNA? How can you tell?
5' ...GGAGCUCGUUGUAUU... 3'

Question 66

Mechanisms that exist to detect and deal with errors in mRNA in order to ensure the accurate transfer of genetic information are collectively referred to as:

A) mRNA surveillance.
B) proofreading function.
C) RNA interference.
D) alternative processing.
E) RNA transition.

Question 67

Which of the following statements about translation is CORRECT?

A) A special tRNA that does not have an attached amino acid binds to stop codons to terminate translation.
B) The first three bases at the 5'end of an mRNA are the AUG at which translation begins.
C) The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
D) In eukaryotes, the 5' cap and the 3'poly(A) tail are involved in translation initiation.
E) Ribosomes move along an mRNA in the 3'to 5' direction.

Question 68

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT?

A) All nascent polypeptide chains have the intrinsic ability to fold into the active conformation based on the primary structure.
B) Only eukaryotic proteins undergo alterations following translation.
C) Amino acids within a protein may be modified by molecular chaperones.
D) Signal sequence of a protein helps direct a protein to a specific location within the cell.
E) Attachment of a protein called ubiquitin directs proteins to enter into the nucleus.

Question 69

What would be the effect on the following amino acid sequence if the sequence were changed to 5'GGAGACUCGUUGUAUU 3'? Explain why the amino acid sequence changes.
5' ...GGAGCUCGUUGUAUU... 3'

Question 70

An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

-Explain why the mutant lysine tRNA allele from the previous question might affect overall cell growth.

Question 71

This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene.
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'

Question 72

A yeast strain was exposed to a chemical mutagen. As expected, exposure to a mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. How do you explain this apparent discrepancy?

Question 73

An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. $$\begin{array} { c c } \text { ade } 1 ^ { + } \text {wild-type allele } & \text { ade1 } ^ { - } \text {mutant allele } \\\text { 5'...TTATGGGCAAGATCCCA...3' } & \text { 5'....TTA TGGGCTAGATCCCA...3' } \\\text { 3'...AATACCCGTTCTAGGGT...5' } & \text { 3'...AATATGGGCTAGATCCCA...3' }\end{array}$$

- E. coli strains that have both the original ade1^- mutant allele shown above and a mutant allele for a gene that encodes a lysine tRNA are able to make some normal ade1 enzyme. The mutant lysine tRNA allele makes tRNA that has one base that is different from the wild-type tRNA. Explain how the lysine tRNA mutation allows synthesis of the normal ade1 enzyme.

Question 74

Which molecule allows the release of mRNA from a stalled ribosome?

A) miRNA
B) snoRNA
C) incRNA
D) tmRNA
E) siRNA

Question 75

Which amino acids are encoded, if the reading frame is as shown below, starting from the correct end?
5' ...GGAGCUCGUUGUAUU... 3'

Question 76

Write the codon, with correct polarity, of all mRNA codons that will bind to the tRNA anticodon 5' GCU 3', considering wobble-base pairing rules.