Question 1

Which of the following mRNA codons will bind to the tRNA anticodon 5' GCU 3', considering wobble-base pairing rules.

Accepted Answer

A)  5' AGU 3' and 5' AGC 3' 
B)  5' UGA 3' and 5' CGA 3' 
C)  5' AGC 3' 
D)  5' CGA 3' 
E)  5'AGU 3', 5' AGC 3', 5' AGA 3', and 5' AGG 3' 
A)  5' AGU 3' and 5' AGC 3' 
B)  5' UGA 3' and 5' CGA 3' 
C)  5' AGC 3' 
D)  5' CGA 3' 
E)  5'AGU 3', 5' AGC 3', 5' AGA 3', and 5' AGG 3' A

Question 2

Use the following to answer questions 
Refer to the following sequence:
5' ...GGAGCUCGUUGUAUU... 3'
-Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end?

Accepted Answer

A)  gly-ala-arg-cys-ile... 
B)  pro-arg-ala-thr-stop 
C)  met-asn-glu-leu… 
D)  glu-leu-val-val-phe… 
E)  leu-glu-gln-his-asn… 
A)  gly-ala-arg-cys-ile... 
B)  pro-arg-ala-thr-stop 
C)  met-asn-glu-leu… 
D)  glu-leu-val-val-phe… 
E)  leu-glu-gln-his-asn… A

Question 3

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

Accepted Answer

A two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene would likely have significant consequences for the resulting protein. Exons are the coding regions of a gene, and any mutation within these regions can directly impact the structure and function of the protein that is produced.

In this case, a two nucleotide-deletion mutation would cause a frameshift mutation, where the reading frame of the gene is shifted, leading to a completely different amino acid sequence downstream of the mutation. This can result in a non-functional or significantly altered protein.

The consequences of this mutation could include the production of a truncated protein, a protein with altered function, or the complete loss of protein production. Depending on the specific gene and protein involved, this could lead to a variety of potential outcomes, including genetic disorders, developmental abnormalities, or an increased risk of certain diseases.

Overall, a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene would likely have detrimental effects on the function of the gene and the resulting protein, with potential implications for the health and development of an organism.

Question 4

Which of the following statements about proteins is INCORRECT?

Accepted Answer

A)  All proteins are made up of some combination of 20 essential amino acids. 
B)  Like nucleic acids, polypeptides have polarity. 
C)  A single polypeptide has primary, secondary, and tertiary structures. 
D)  $\alpha$-helix and $\beta$-pleated sheets do not require a specific sequence of amino acids to form. 
E)  Some proteins contain more than one polypeptide chain. 
A)  All proteins are made up of some combination of 20 essential amino acids. 
B)  Like nucleic acids, polypeptides have polarity. 
C)  A single polypeptide has primary, secondary, and tertiary structures. 
D)  $\alpha$-helix and $\beta$-pleated sheets do not require a specific sequence of amino acids to form. 
E)  Some proteins contain more than one polypeptide chain.

Question 5

What is the function of peptidyl transferase activity?

Accepted Answer

A)  It charges tRNAs. 
B)  It acetylates the end of a protein after translation. 
C)  It cleaves the polypeptide from the last tRNA during termination. 
D)  It moves ribosomes along mRNA during translation. 
E)  It forms peptide bonds. 
A)  It charges tRNAs. 
B)  It acetylates the end of a protein after translation. 
C)  It cleaves the polypeptide from the last tRNA during termination. 
D)  It moves ribosomes along mRNA during translation. 
E)  It forms peptide bonds.

Question 6

You identify a novel deep-sea vent (DSV) bacteria and wish to explore its molecular biology. You find that you can introduce DNA sequences into the bacteria and it will transcribe and translate those sequences. However, you notice some curious differences between the expected proteins and the actual proteins produced.
a. A 9-bp DNA sequence that in E. coli encodes a short peptide of Met-Trp-Phe instead produces a peptide of Met-Cys-Val-Trp-Gly-Val-Phe in the DSV bacteria. What is the sequence of the coding strand of the short DNA fragment? Propose an explanation for the longer peptide produced by the DSV bacteria.
b. Curiously, a 9-bp sequence that in E. coli produces a peptide of Met-Thr-Asn does not produce any peptide in the DSV bacteria. What is the sequence of the coding strand of this DNA fragment? Propose an explanation for the absence of any peptide.

Accepted Answer

a. The sequence of the coding strand of

Question 7

Which of the following statements does NOT describe the events in prokaryotic translation elongation?

Accepted Answer

A)  The nucleotides in the Shine-Dalgarno sequence of the mRNA pair with their complementary nucleotides in the 16S rRNA. 
B)  A ribosome with a growing peptide attached to a tRNA in the P site accepts a charged tRNA with the next amino acid into the A site. The charged tRNA enters as a complex with EF-Tu and GTP. 
C)  If the anticodon of the charged tRNA matches the codon, GTP is cleaved and EF-Tu exits and is regenerated to EF-Tu-GTP by EF-Ts. 
D)  A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site. 
E)  The ribosome translocates toward the 3' end of the mRNA with the aid of EF-G and GTP hydrolysis. The empty tRNA that was in the P site moves to the E site and exits. The tRNA with the polypeptide that was in the A site moves to the P site. 
A)  The nucleotides in the Shine-Dalgarno sequence of the mRNA pair with their complementary nucleotides in the 16S rRNA. 
B)  A ribosome with a growing peptide attached to a tRNA in the P site accepts a charged tRNA with the next amino acid into the A site. The charged tRNA enters as a complex with EF-Tu and GTP. 
C)  If the anticodon of the charged tRNA matches the codon, GTP is cleaved and EF-Tu exits and is regenerated to EF-Tu-GTP by EF-Ts. 
D)  A peptide bond is formed by the peptidyl transferase activity of the large subunit rRNA. The polypeptide chain on the tRNA in the P site is transferred to the amino acid on the tRNA in the A site. 
E)  The ribosome translocates toward the 3' end of the mRNA with the aid of EF-G and GTP hydrolysis. The empty tRNA that was in the P site moves to the E site and exits. The tRNA with the polypeptide that was in the A site moves to the P site.

Question 8

This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene.
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'

Accepted Answer

The DNA sequence provided is: 5'ATGGGAGC

Question 9

Use the following to answer questions  
-If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

Accepted Answer

A)  AUAGGCAGU. 
B)  UCCCAGGUG. 
C)  CACCUGGGA. 
D)  AGGGUCCAC. 
E)  GACAUUAGA. 
A)  AUAGGCAGU. 
B)  UCCCAGGUG. 
C)  CACCUGGGA. 
D)  AGGGUCCAC. 
E)  GACAUUAGA.

Question 10

Which one of the following codons codes for a different amino acid from the rest?

Accepted Answer

A)  CUU 
B)  CUC 
C)  UUA 
D)  UUU 
E)  CUA 
A)  CUU 
B)  CUC 
C)  UUA 
D)  UUU 
E)  CUA

Question 11

The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to encode each amino acid?

Accepted Answer

The genetic code is a set of rules by wh

Question 12

Use the following to answer questions :  
-The next step in the translation of this mRNA will be the formation of a peptide bond between which two of the numbered amino acids?

Accepted Answer

A)  amino acid 2 and amino acid 3 
B)  amino acid 2 and amino acid 4 
C)  amino acid 1 and amino acid 3 
D)  amino acid 1 and amino acid 2 
E)  amino acid 3 and amino acid 4 
A)  amino acid 2 and amino acid 3 
B)  amino acid 2 and amino acid 4 
C)  amino acid 1 and amino acid 3 
D)  amino acid 1 and amino acid 2 
E)  amino acid 3 and amino acid 4

Question 13

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing.

Accepted Answer

A)  5'base 
B)  middle base 
C)  3' base 
A)  5'base 
B)  middle base 
C)  3' base

Question 14

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT?

Accepted Answer

A)  All nascent polypeptide chains have the intrinsic ability to fold into the active conformation based on the primary structure. 
B)  Only eukaryotic proteins undergo alterations following translation. 
C)  Amino acids within a protein may be modified by molecular chaperones. 
D)  Signal sequence of a protein helps direct a protein to a specific location within the cell. 
E)  Attachment of a protein called ubiquitin directs proteins to enter into the nucleus. 
A)  All nascent polypeptide chains have the intrinsic ability to fold into the active conformation based on the primary structure. 
B)  Only eukaryotic proteins undergo alterations following translation. 
C)  Amino acids within a protein may be modified by molecular chaperones. 
D)  Signal sequence of a protein helps direct a protein to a specific location within the cell. 
E)  Attachment of a protein called ubiquitin directs proteins to enter into the nucleus.

Question 15

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy?

Accepted Answer

A)  The DNA sequence change occurred in a synonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. 
B)  If the protein sequence was not affected, no lethal phenotype manifested. 
C)  The DNA sequence change resulted in an amino acid change, but that amino acid change had no negative effect on protein function (i.e., was a neutral change). 
D)  The DNA sequence change occurred in a nonsynonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. 
E)  All mutations that cause a change in DNA sequence result in a lethal phenotype. 
A)  The DNA sequence change occurred in a synonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. 
B)  If the protein sequence was not affected, no lethal phenotype manifested. 
C)  The DNA sequence change resulted in an amino acid change, but that amino acid change had no negative effect on protein function (i.e., was a neutral change). 
D)  The DNA sequence change occurred in a nonsynonymous nucleotide position of an amino acid and as a result the protein sequence remained unaltered. 
E)  All mutations that cause a change in DNA sequence result in a lethal phenotype.

Question 16

Which amino acids are encoded, if the reading frame is as shown below, starting from the correct end?
5' ...GGAGCUCGUUGUAUU... 3'

Accepted Answer

To determine which amino acids are encod

Question 17

What was the key technical deficiency that prevented Nirenberg and colleagues from deciphering the genetic code? What were the two important breakthroughs that still allowed them to break the genetic code?

Accepted Answer

The key technical deficiency that preven

Question 18

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

Accepted Answer

A)  The result would be no change in the protein, since deletions are very rare. 
B)  A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. 
C)  Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. 
D)  Since exons are not coding regions, no changes in the protein would occur. 
E)  No change in the reading frame would occur due to the degeneracy of the genetic code. 
A)  The result would be no change in the protein, since deletions are very rare. 
B)  A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. 
C)  Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. 
D)  Since exons are not coding regions, no changes in the protein would occur. 
E)  No change in the reading frame would occur due to the degeneracy of the genetic code.

Question 19

E. coli only has a single tryptophan tRNA gene. Why, given this arrangement, might it be difficult to identify mutants that alter the anticodon of this tRNA gene?

Accepted Answer

The difficulty in identifying mutants th

Question 20

Translating an mRNA requires two other types of RNA:

Accepted Answer

A)  tRNA and mRNA. 
B)  tRNA and miRNA. 
C)  tRNA and rRNA. 
D)  rRNA and siRNA. 
E)  snRNA and snoRNA. 
A)  tRNA and mRNA. 
B)  tRNA and miRNA. 
C)  tRNA and rRNA. 
D)  rRNA and siRNA. 
E)  snRNA and snoRNA.

Exam 15: The Genetic Code and Translation

Which of the following mRNA codons will bind to the tRNA anticodon 5' GCU 3', considering wobble-base pairing rules.

Use the following to answer questions Refer to the following sequence: 5' ...GGAGCUCGUUGUAUU... 3' -Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end?

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

Which of the following statements about proteins is INCORRECT?

What is the function of peptidyl transferase activity?

Which of the following statements does NOT describe the events in prokaryotic translation elongation?

This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene. 5' ATGGGAGCTCGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5'

Use the following to answer questions -If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

Which one of the following codons codes for a different amino acid from the rest?

The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to encode each amino acid?

Use the following to answer questions : -The next step in the translation of this mRNA will be the formation of a peptide bond between which two of the numbered amino acids?

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing.

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT?

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy?

Which amino acids are encoded, if the reading frame is as shown below, starting from the correct end? 5' ...GGAGCUCGUUGUAUU... 3'

What was the key technical deficiency that prevented Nirenberg and colleagues from deciphering the genetic code? What were the two important breakthroughs that still allowed them to break the genetic code?

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

E. coli only has a single tryptophan tRNA gene. Why, given this arrangement, might it be difficult to identify mutants that alter the anticodon of this tRNA gene?

Translating an mRNA requires two other types of RNA:

Introduction to Genetics

Chromosomes and Cellular Reproduction

Basic Principles of Heredity

Sex Determination and Sex-Linked Characteristics

Extensions and Modifications of Basic Principles

Pedigree Analysis, Applications, and Genetic Testing

Linkage, Recombination, and Eukaryotic Gene Mapping

Chromosome Variation

Bacterial and Viral Genetic Systems

DNA: the Chemical Nature of the Gene

Chromosome Structure and Organelle Dna

DNA Replication and Recombination

Transcription

Rna Molecules and Rna Processing

Control of Gene Expression in Prokaryotes

Control of Gene Expression in Eukaryotes

Gene Mutations and Dna Repair

Molecular Genetic Analysis and Biotechnology

Genomics and Proteomics

Epigenetics

Developmental Genetics and Immunogenetics

Cancer Genetics

Quantitative Genetics

Population Genetics

Evolutionary Genetics

Filters