Exam 15: The Genetic Code and Translation

arrow
  • Select Tags
search iconSearch Question
  • Select Tags

Which of the following mRNA codons will bind to the tRNA anticodon 5' GCU 3', considering wobble-base pairing rules.

Free
(Multiple Choice)
4.8/5
(30)
Correct Answer:
Verified

A

Use the following to answer questions Refer to the following sequence: 5' ...GGAGCUCGUUGUAUU... 3' -Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end?

Free
(Multiple Choice)
4.8/5
(37)
Correct Answer:
Verified

A

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

Free
(Essay)
4.7/5
(30)
Correct Answer:
Answered by Examlex AI Copilot

A two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene would likely have significant consequences for the resulting protein. Exons are the coding regions of a gene, and any mutation within these regions can directly impact the structure and function of the protein that is produced.

In this case, a two nucleotide-deletion mutation would cause a frameshift mutation, where the reading frame of the gene is shifted, leading to a completely different amino acid sequence downstream of the mutation. This can result in a non-functional or significantly altered protein.

The consequences of this mutation could include the production of a truncated protein, a protein with altered function, or the complete loss of protein production. Depending on the specific gene and protein involved, this could lead to a variety of potential outcomes, including genetic disorders, developmental abnormalities, or an increased risk of certain diseases.

Overall, a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene would likely have detrimental effects on the function of the gene and the resulting protein, with potential implications for the health and development of an organism.

Which of the following statements about proteins is INCORRECT?

(Multiple Choice)
5.0/5
(29)

What is the function of peptidyl transferase activity?

(Multiple Choice)
4.8/5
(34)

You identify a novel deep-sea vent (DSV) bacteria and wish to explore its molecular biology. You find that you can introduce DNA sequences into the bacteria and it will transcribe and translate those sequences. However, you notice some curious differences between the expected proteins and the actual proteins produced. a. A 9-bp DNA sequence that in E. coli encodes a short peptide of Met-Trp-Phe instead produces a peptide of Met-Cys-Val-Trp-Gly-Val-Phe in the DSV bacteria. What is the sequence of the coding strand of the short DNA fragment? Propose an explanation for the longer peptide produced by the DSV bacteria. b. Curiously, a 9-bp sequence that in E. coli produces a peptide of Met-Thr-Asn does not produce any peptide in the DSV bacteria. What is the sequence of the coding strand of this DNA fragment? Propose an explanation for the absence of any peptide.

(Essay)
4.8/5
(34)

Which of the following statements does NOT describe the events in prokaryotic translation elongation?

(Multiple Choice)
4.7/5
(26)

This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene. 5' ATGGGAGCTCGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5'

(Essay)
4.8/5
(35)

Use the following to answer questions Use the following to answer questions   -If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is: -If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

(Multiple Choice)
4.9/5
(31)

Which one of the following codons codes for a different amino acid from the rest?

(Multiple Choice)
4.7/5
(29)

The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to encode each amino acid?

(Short Answer)
4.9/5
(37)

Use the following to answer questions : Use the following to answer questions :   -The next step in the translation of this mRNA will be the formation of a peptide bond between which two of the numbered amino acids? -The next step in the translation of this mRNA will be the formation of a peptide bond between which two of the numbered amino acids?

(Multiple Choice)
4.9/5
(35)

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing.

(Multiple Choice)
4.7/5
(35)

Which of the following statements about protein folding and posttranslational modifications of proteins is CORRECT?

(Multiple Choice)
4.8/5
(35)

A yeast strain was exposed to chemical mutagen. As expected, exposure to mutagen resulted in a DNA sequence change in an essential gene you examined. Yet this mutation did not result in any lethal phenotype. Which of the following answers would BEST explain this apparent discrepancy?

(Multiple Choice)
4.8/5
(36)

Which amino acids are encoded, if the reading frame is as shown below, starting from the correct end? 5' ...GGAGCUCGUUGUAUU... 3'

(Short Answer)
4.9/5
(39)

What was the key technical deficiency that prevented Nirenberg and colleagues from deciphering the genetic code? What were the two important breakthroughs that still allowed them to break the genetic code?

(Short Answer)
4.9/5
(40)

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene?

(Multiple Choice)
4.8/5
(30)

E. coli only has a single tryptophan tRNA gene. Why, given this arrangement, might it be difficult to identify mutants that alter the anticodon of this tRNA gene?

(Essay)
4.8/5
(39)

Translating an mRNA requires two other types of RNA:

(Multiple Choice)
4.8/5
(36)
Showing 1 - 20 of 76
close modal

Filters

  • Essay(0)
  • Multiple Choice(0)
  • Short Answer(0)
  • True False(0)
  • Matching(0)