Deck 6: Molecular Diagnostics

Question 1

Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure used stated that 10 µg was optimal. The laboratory's result can be explained by all of the factors below EXCEPT:

A) A low patient white blood cell count.
B) Inadequate harvesting of the buffy coat from the sample.
C) Storage of the whole blood sample at 22°C for 12 hrs prior to use.
D) Contamination of the sample with protein.

Answer 1

Inadequate harvesting of the buffy coat from the sample.

Question 2

The melting temperature (Tm) of the DNA sequence given below is:
5' TAACCTATGCGA 3'
3' ATTGGATACGCT 5'

A) 12°C.
B) 24°C.
C) 34°C.
D) 38°C.

Answer 2

38°C.

Question 3

Which of the following is a step in the process of translation?

A) RNA polymerase binds to the promoter sequence.
B) Introns are removed from the transcript.
C) A string of A's are added to the 3' end of the mRNA.
D) Anticodons on the tRNAs bind to their complementary codons on mRNA.

Answer 3

Introns are removed from the transcript.

Question 4

How much DNA would be contained in 200 ?g of a sample that has an absorbance at 260nm of 0.40 and an absorbance at 280nm of 0.20?

A) 4 ?g
B) 6 ?g
C) 8 ?g
D) 10 ?g

Question 5

Which of the following is TRUE about gel electrophoresis of DNA?

A) DNA of smaller molecular weight will travel far from the point of application.
B) DNA migrates toward the cathode.
C) Increasing the voltage increases the resolution of DNA fragments separated in the gel.
D) DNA electrophoresis requires polyacrylamide as a matrix.

Question 6

Restriction endonucleases function by:

A) Linking 2 pieces of DNA from different sources.
B) Adding a phosphate group onto one end of the DNA.
C) Cutting the DNA at specific nucleotide sequences.
D) Breaking the DNA randomly to create fragments of manageable size.

Question 7

All of the following are clinical applications of FISH EXCEPT:

A) Detection of chromosome microdeletions.
B) Detection of oncogenes in tumor cells.
C) Monitoring patients with sex-mismatched bone marrow transplants for engraftment.
D) Detecting DNA from tumor-causing viruses in cytologic specimens.

Question 8

RNA differs from DNA in that RNA:

A) Contains thymine instead of uracil.
B) Contains an H group instead of an OH group at its number 2 carbon.
C) Is normally single-stranded.
D) Is used to carry the genetic information of most viruses.

Question 9

The protein product derived from the DNA sequence below contains which of the following amino acid sequences?
DNA: 3' TACTTTCGCGGAACT 5'

A) Tyrosine-phenylalanine-arginine-glycine-threonine
B) Tyrosine-phenylalanine-arginine-glycine
C) Methionine-lysine-alanine-proline
D) Methionine-lysine-alanine-proline-tryptophan

Question 10

Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is:

A) Agarose gel electrophoresis.
B) Polyacrylamide gel electrophoresis.
C) Pulse-field gel electrophoresis.
D) Denaturing gel electrophoresis.

Question 11

Which of the following fragments would be generated when the following sequence is cut by SmaI?
5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3'

A) One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment
B) One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment
C) Two 19 bp fragments
D) One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment

Question 12

Real-time PCR differs from traditional PCR in that:

A) Primers are not necessary.
B) The amplicon is detected as the reaction progresses.
C) The amplicon is detected on a special fluorescent gel.
D) The reaction requires hybridization probes.

Question 13

More nonspecific binding of a probe to DNA sequences in a sample is encouraged when:

A) The size of the probe is increased.
B) The salt concentration is decreased.
C) The temperature is decreased.
D) The temperature is increased.

Question 14

Labeled antibodies are used as probes to detect proteins in:

A) Hybrid capture assay.
B) Northern blot.
C) Southern blot.
D) Western blot.

Question 15

A suitable method to use for quantitation of HIV in patient blood is:

A) bDNA.
B) DNA sequencing.
C) SDA.
D) Southern blot.