Question 1

Real-time PCR differs from traditional PCR in that:

Accepted Answer

A)  Primers are not necessary. 
B)  The amplicon is detected as the reaction progresses. 
C)  The amplicon is detected on a special fluorescent gel. 
D)  The reaction requires hybridization probes. 
A)  Primers are not necessary. 
B)  The amplicon is detected as the reaction progresses. 
C)  The amplicon is detected on a special fluorescent gel. 
D)  The reaction requires hybridization probes. D

Question 2

Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is:

Accepted Answer

A)  Agarose gel electrophoresis. 
B)  Polyacrylamide gel electrophoresis. 
C)  Pulse-field gel electrophoresis. 
D)  Denaturing gel electrophoresis. 
A)  Agarose gel electrophoresis. 
B)  Polyacrylamide gel electrophoresis. 
C)  Pulse-field gel electrophoresis. 
D)  Denaturing gel electrophoresis. C

Question 3

The melting temperature (Tm) of the DNA sequence given below is:
5' TAACCTATGCGA 3'
3' ATTGGATACGCT 5'

Accepted Answer

A)  12°C. 
B)  24°C. 
C)  34°C. 
D)  38°C. 
A)  12°C. 
B)  24°C. 
C)  34°C. 
D)  38°C. D

Question 4

Which of the following is a step in the process of translation?

Accepted Answer

A)  RNA polymerase binds to the promoter sequence. 
B)  Introns are removed from the transcript. 
C)  A string of A's are added to the 3' end of the mRNA. 
D)  Anticodons on the tRNAs bind to their complementary codons on mRNA. 
A)  RNA polymerase binds to the promoter sequence. 
B)  Introns are removed from the transcript. 
C)  A string of A's are added to the 3' end of the mRNA. 
D)  Anticodons on the tRNAs bind to their complementary codons on mRNA.

Question 5

Labeled antibodies are used as probes to detect proteins in:

Accepted Answer

A)  Hybrid capture assay. 
B)  Northern blot. 
C)  Southern blot. 
D)  Western blot. 
A)  Hybrid capture assay. 
B)  Northern blot. 
C)  Southern blot. 
D)  Western blot.

Question 6

How much DNA would be contained in 200 ?g of a sample that has an absorbance at 260nm of 0.40 and an absorbance at 280nm of 0.20?

Accepted Answer

A)  4 ?g 
B)  6 ?g 
C)  8 ?g 
D)  10 ?g 
A)  4 ?g 
B)  6 ?g 
C)  8 ?g 
D)  10 ?g

Question 7

Which of the following is TRUE about gel electrophoresis of DNA?

Accepted Answer

A)  DNA of smaller molecular weight will travel far from the point of application. 
B)  DNA migrates toward the cathode. 
C)  Increasing the voltage increases the resolution of DNA fragments separated in the gel. 
D)  DNA electrophoresis requires polyacrylamide as a matrix. 
A)  DNA of smaller molecular weight will travel far from the point of application. 
B)  DNA migrates toward the cathode. 
C)  Increasing the voltage increases the resolution of DNA fragments separated in the gel. 
D)  DNA electrophoresis requires polyacrylamide as a matrix.

Question 8

Restriction endonucleases function by:

Accepted Answer

A)  Linking 2 pieces of DNA from different sources. 
B)  Adding a phosphate group onto one end of the DNA. 
C)  Cutting the DNA at specific nucleotide sequences. 
D)  Breaking the DNA randomly to create fragments of manageable size. 
A)  Linking 2 pieces of DNA from different sources. 
B)  Adding a phosphate group onto one end of the DNA. 
C)  Cutting the DNA at specific nucleotide sequences. 
D)  Breaking the DNA randomly to create fragments of manageable size.

Question 9

The protein product derived from the DNA sequence below contains which of the following amino acid sequences?
DNA: 3' TACTTTCGCGGAACT 5'

Accepted Answer

A)  Tyrosine-phenylalanine-arginine-glycine-threonine 
B)  Tyrosine-phenylalanine-arginine-glycine 
C)  Methionine-lysine-alanine-proline 
D)  Methionine-lysine-alanine-proline-tryptophan 
A)  Tyrosine-phenylalanine-arginine-glycine-threonine 
B)  Tyrosine-phenylalanine-arginine-glycine 
C)  Methionine-lysine-alanine-proline 
D)  Methionine-lysine-alanine-proline-tryptophan

Question 10

Which of the following fragments would be generated when the following sequence is cut by SmaI?
5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3'

Accepted Answer

A)  One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment 
B)  One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment 
C)  Two 19 bp fragments 
D)  One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment 
A)  One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment 
B)  One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment 
C)  Two 19 bp fragments 
D)  One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment

Question 11

More nonspecific binding of a probe to DNA sequences in a sample is encouraged when:

Accepted Answer

A)  The size of the probe is increased. 
B)  The salt concentration is decreased. 
C)  The temperature is decreased. 
D)  The temperature is increased. 
A)  The size of the probe is increased. 
B)  The salt concentration is decreased. 
C)  The temperature is decreased. 
D)  The temperature is increased.

Question 12

All of the following are clinical applications of FISH EXCEPT:

Accepted Answer

A)  Detection of chromosome microdeletions. 
B)  Detection of oncogenes in tumor cells. 
C)  Monitoring patients with sex-mismatched bone marrow transplants for engraftment. 
D)  Detecting DNA from tumor-causing viruses in cytologic specimens. 
A)  Detection of chromosome microdeletions. 
B)  Detection of oncogenes in tumor cells. 
C)  Monitoring patients with sex-mismatched bone marrow transplants for engraftment. 
D)  Detecting DNA from tumor-causing viruses in cytologic specimens.

Question 13

Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure used stated that 10 µg was optimal. The laboratory's result can be explained by all of the factors below EXCEPT:

Accepted Answer

A)  A low patient white blood cell count. 
B)  Inadequate harvesting of the buffy coat from the sample. 
C)  Storage of the whole blood sample at 22°C for 12 hrs prior to use. 
D)  Contamination of the sample with protein. 
A)  A low patient white blood cell count. 
B)  Inadequate harvesting of the buffy coat from the sample. 
C)  Storage of the whole blood sample at 22°C for 12 hrs prior to use. 
D)  Contamination of the sample with protein.

Question 14

A suitable method to use for quantitation of HIV in patient blood is:

Accepted Answer

A)  bDNA. 
B)  DNA sequencing. 
C)  SDA. 
D)  Southern blot. 
A)  bDNA. 
B)  DNA sequencing. 
C)  SDA. 
D)  Southern blot.

Question 15

RNA differs from DNA in that RNA:

Accepted Answer

A)  Contains thymine instead of uracil. 
B)  Contains an H group instead of an OH group at its number 2 carbon. 
C)  Is normally single-stranded. 
D)  Is used to carry the genetic information of most viruses. 
A)  Contains thymine instead of uracil. 
B)  Contains an H group instead of an OH group at its number 2 carbon. 
C)  Is normally single-stranded. 
D)  Is used to carry the genetic information of most viruses.

Exam 6: Molecular Diagnostics

Real-time PCR differs from traditional PCR in that:

Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is:

The melting temperature (Tm) of the DNA sequence given below is: 5' TAACCTATGCGA 3' 3' ATTGGATACGCT 5'

Which of the following is a step in the process of translation?

Labeled antibodies are used as probes to detect proteins in:

How much DNA would be contained in 200 ?g of a sample that has an absorbance at 260nm of 0.40 and an absorbance at 280nm of 0.20?

Which of the following is TRUE about gel electrophoresis of DNA?

Restriction endonucleases function by:

The protein product derived from the DNA sequence below contains which of the following amino acid sequences? DNA: 3' TACTTTCGCGGAACT 5'

Which of the following fragments would be generated when the following sequence is cut by SmaI? 5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3'

More nonspecific binding of a probe to DNA sequences in a sample is encouraged when:

All of the following are clinical applications of FISH EXCEPT:

Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure used stated that 10 µg was optimal. The laboratory's result can be explained by all of the factors below EXCEPT:

A suitable method to use for quantitation of HIV in patient blood is:

RNA differs from DNA in that RNA:

Laboratory Basics

Safety in the Clinical Chemistry Laboratory

Laboratory Statistics, Method Development and QC

Instrumentation, Laboratory Automation, and Informatics

Immunoassays

Carbohydrates

Lipids

Proteins

Enzymes

Nonprotein Nitrogen Questions

Body Water and Electrolyte Homeostasis

Blood Gases, PH, and Acid-Base Balance

Mineral and Bone Metabolism

The Endocrine System

Gastrointestinal Function

Pancreas

Cardiac Function

Liver

Iron, Porphyrins, and Hemoglobin

Therapeutic Drug Monitoring

Toxic Substances

Nutrition and Vitamins

Tumor Markers

Geriatrics

Pediatrics

Filters