Deck 9: Digital Analysis of Genomes

Question 1

Why does a genomic library need more clones than what would be estimated by calculations to be complete?

A)There is a significant probability that some sequences would not be represented in a library if it was only the calculated size
B)The restrriction enzyme that is used to prepare the DNA for cloning will not digest certain sequences within the DNA.
C)The restriction enzyme used to prepare the DNA for cloning sometimes leaves a different sticky end
D)Restriction enzymes cleave DNA preferentially at the ends of open reading frames so coding regions are prefereentially cloned.

Answer 1

There is a significant probability that some sequences would not be represented in a library if it was only the calculated size

Question 2

What enzyme is necessary for the copying of mRNA sequence into DNA during cDNA library construction?

A)RNA polymerase
B)DNA polymerase
C)Reverse transcriptase
D)Restriction endonuclease

Answer 2

Reverse transcriptase

Question 3

What is the function of the amp^r gene in a vector?

A)It is a restriction enzyme recognition site.
B)It is a selectable marker.
C)It is the origin of replication.
D)It makes the enzyme ß-galactosidase if it is intact, indicating vectors without inserts.
E)It is required for packing into viral shells.

Answer 3

It is a selectable marker.

Question 4

How do bacteria protect their own DNA from the restriction enzymes they produce?

A)Their DNA never contains the recognition site.
B)Ligase connects their DNA as soon as it is cut.
C)Digestion is blocked by methyl groups added to recognition sequences in their DNA.
D)Phosphate groups added to the recognition sequences in their DNA block digestion.
E)Restriction enzymes are blocked from entry into the nucleus.

Question 5

What information cannot be determined from the DNA sequence of a cDNA clone?

A)exon sequences
B)sequence of the promoter
C)similarity to previously identified sequences
D)amino acid sequence of the encoded polypeptides
E)sequence of the spliced mRNA transcript

Question 6

How are open reading frames or exons predicted from genomic sequence?

A)If the open reading frame is 10 amino acids long it is considered an exon.
B)If the sequence is absent in mRNA it is considered an exon.
C)If there is a splice donor and acceptor site at the ends of the open reading frame it is considered an exon.
D)If an open reading frame is 21 amino acids long or longer it is accepted as an exon.

Question 7

Pseudogenes are evidence for

A)gene duplications.
B)the existence of integrated viruses, or proviruses.
C)the importance of TATA boxes in eukaryotic promoters.
D)the importance of the order of the globin genes in dictating their expression.
E)diseases that result from deletions in the a-globin genes.

Question 8

How are the genes in the $\beta$ -globin locus different from each other?

A)They use different template strands for transcription.
B)They are expressed at different times in development.
C)They have different evolutionary origins, from different ancestral genes.
D)They are dispersed on different chromosomes.
E)Some are expressed in all cells; some are expressed only in red blood cells.

Question 9

In gel electrophoresis of DNA, fragments move at different rates because they have different

A)charge densities.
B)sizes.
C)base sequences.
D)amino acid compositions.
E)electrical strengths.

Question 10

Which of the following is an example of a recombinant DNA molecule?

A)a single-stranded RNA hybridized to a single-stranded DNA
B)a genomic fragment of human DNA ligated to a bacterial plasmid vector
C)a $\lambda$ chromosome in a bacterial cell
D)a bacterial plasmid cut with a restriction enzyme

Question 11

What is the advantage of having different forms of hemoglobin?

A)The advantage is that it allowed for speciation.
B)The multiple forms all have the same function so that one can be mutated without affecting the individual..
C)There is no advantage
D)The different forms are adapted to most efficiently carry oxygen in the different stage of development.

Question 12

In Sanger sequencing, what causes DNA synthesis to terminate at a specific base?

A)chemicals that cleave DNA after particular bases
B)fluorescent chemicals
C)nucleotide triphosphates that lack a base
D)nucleotide triphosphates that lack a hydroxyl at the 3' position
E)nucleosides that lack a 5' phosphate

Question 13

Which choice is NOT a characteristic of a plasmid used as a cloning vector?

A)contains a selectable marker.
B)contains an origin of replication.
C)has a site for inserting foreign DNA.
D)integrates into the host chromosome.

Question 14

Use the BLAST tool at http://blast.ncbi.nlm.nih.gov/Blast.cgi and click "Protein blast" to find out the identity of the protein with the following amino acid sequence: CCKHPEAKRM PCAEDYLSVV LNQLCVLHEK TPVSDRVTKC CTESLVNRRP

A)myosin
B)actin
C)albumin
D)DNA polymerase
E)tubulin

Question 15

The BLAST suite of programs can be used to

A)compare a nucleotide or amino acid sequence to databases from a variety of species.
B)display the reading frames of nucelotide sequence.
C)find the tissues that a nucleotide sequence might be expressed in.
D)analyze microarray data.
E)tubulin

Question 16

What proportion of the genome is comprised of the exome?

A)< 0.1%
B)2%
C)10%
D)20%
E)45%

Question 17

Reverse transcriptase is an enzyme made by

A)red blood cells.
B)phage $\lambda$ .
C)retroviruses.
D)yeast.
E)E.coli.

Question 18

Where do restriction enzymes come from, and what is their normal physiological function?

A)Phage $\lambda$ produces them and they replicate viral DNA.
B)Phage $\lambda$ produces them and they confer antibiotic resistance.
C)They are yeast DNA replication enzymes.
D)Bacteria produce them to protect against viral invasion.
E)They are bacterial DNA replication enzymes.

Question 19

What is one difference between using restriction endonucleases and mechanical shearing of DNA?

A)Restriction endonucleases digest at known specific sites while shearing occurs at random sites.
B)Restriction endonucleases digest at random sites while shearing occurs at known specific sites.
C)Restriction enzymes are a mechanical process while shearing occurs using proteins.
D)Restriction enzymes produce larger fragments on average than shearing.

Question 20

If DNA had 5 different bases, a restriction enzyme with a 4-base recognition sequence would predicted to digest the DNA approximately every

A)125 bp.
B)256 bp.
C)425 bp.
D)625 bp.
E)1056 bp.

Question 21

Which of the following is a way that protein function can be modified AFTER translation?

A)Protein cleaving
B)Transcription regulation
C)Genome duplication
D)Exon shuffling
E)Gene rearrangement

Question 22

After digestion of DNA with a restriction endonuclease, which statement is true about the resulting DNA fragments?

A)They will have either a single stranded overhang or blunt ends, depending on the enzyme used.
B)They will have only blunt ends.
C)They will have only single stranded overhangs.
D)The result cannot be predicted because a single restriction enzyme can generate either single stranded overhangs or blunt ends.

Question 23

Which of the following is a potential mechanism through which proteins can acquire novel domain architectures over evolutionary time?

A)Genome duplication alone
B)Exon shuffling alone
C)Exon shuffling followed by genome duplication
D)Genome duplication followed by exon shuffling

Question 24

The role of the DNA polymerase in Sanger sequencing is to

A)synthesize a copy of the template strand in the 5' to 3' direction.
B)synthesize the template strand in the 3' to 5' direction
C)synthesize a copy of the template strand in the 3' to 5' direction.
D)synthesize the template strand in the 5' to 3' direction

Question 25

What is the use of a RefSeq?

A)A RefSeq is a single, complete, annotated version of a species sequence that can be accessed for bioinformatic studies.
B)RefSeq is constantly updated to give the latest information for bioinformatic studies.
C)RefSeq is a program to compare genome sequencces.
D)RefSeq is a program that identifies open reading frames.

Question 26

What is the sequence of the template DNA used for this sequencing reaction?

A)5' TTTGCTTTGTGAGCGGATAACAA 3'
B)3' TTTGCTTTGTGAGCGGATAACAA 5'
C)5' AAACGAAACACTCGCCTATTGTT 3'
D)3' AAACGAAACACTCGCCTATTGTT 5'

Question 27

What is the purpose of ethidium bromide in DNA electrophoresis?

A)To label DNA fragments so they can be viewed under UV light
B)To introduce mutations into the DNA
C)To fragment the DNA before separating them by size
D)To join fragments of DNA together

Question 28

Why is it necessary to obtain overlapping sequences when performing genomic sequencing?

A)To assemble the whole genome sequence from random fragments.
B)To quantify the amount of DNA in the genome.
C)To make sure all the clones in a library are used.
D)To allow for errors in sequencing to be corrected.

Question 29

The method of sequencing genomic fragments cloned directly from the genome is:

A)Cytogenetic mapping
B)Shotgun sequencing
C)Southern blotting
D)Polymerase chain reaction

Question 30

If it is desired to clone the largest fragments possible from a genome, which vector would be the most appropriate?

A)YAC
B)BAC
C)Plasmid
D)Virus

Question 31

What do you predict would be the effect of an inversion mutation in the $\beta$ -globin gene cluster?

A)No globin genes will be expressed and the fetus will die in utero.
B) $\varepsilon$ -globin will be expressed first during development.
C)The order of globin gene expression will be reversed; the effect on the fetus cannot be predicted.
D)The fetal will develop sickle-cell disease in adult life.

Question 32

Which disease results from deletion of the $\beta$ -globin gene cluster LCR?

A)Sickle-cell disease
B)Mild $\beta$ -thalassemia.
C)Severe $\alpha$ -thalassemia.
D)Mild $\beta$ -thalassemia
E)Severe $\beta$ -thalassemia

Question 33

Which of the following processes is a way that orthologous genes can be generated over evolutionary time?

A)Protein cleaving
B)Transcription regulation
C)Genome duplication
D)Chromosomal rearrangement

Question 34

What is the sequence of the DNA synthesized in the sequencing reaction?

A)5' TTTGCTTTGTGAGCGGATAACAA 3'
B)3' TTTGCTTTGTGAGCGGATAACAA 5'
C)5' AAACGAAACACTCGCCTATTGTT 3'
D)3' AAACGAAACACTCGCCTATTGTT 5'

Question 35

What is one way that genes can be predicted in genome sequences?

A)Identifying the most conserved sequences between different species.
B)Identifying the least conserved sequences between different species
C)Identifying the most conserved regions between individuals of the same species.
D)Determining which regions have undergone the most rapid evolution.