Question 1

What is the function of the ampr gene in a vector?

Accepted Answer

A) It is a restriction enzyme recognition site. 
B) It is a selectable marker. 
C) It is the origin of replication. 
D) It makes the enzyme ß-galactosidase if it is intact, indicating vectors without inserts. 
E) It is required for packing into viral shells. 
A) It is a restriction enzyme recognition site. 
B) It is a selectable marker. 
C) It is the origin of replication. 
D) It makes the enzyme ß-galactosidase if it is intact, indicating vectors without inserts. 
E) It is required for packing into viral shells. B

Question 2

What is the purpose of ethidium bromide in DNA electrophoresis?

Accepted Answer

A) To label DNA fragments so they can be viewed under UV light 
B) To introduce mutations into the DNA 
C) To fragment the DNA before separating them by size 
D) To join fragments of DNA together 
A) To label DNA fragments so they can be viewed under UV light 
B) To introduce mutations into the DNA 
C) To fragment the DNA before separating them by size 
D) To join fragments of DNA together A

Question 3

Which choice is NOT a characteristic of a plasmid used as a cloning vector?

Accepted Answer

A) contains a selectable marker. 
B) contains an origin of replication. 
C) has a site for inserting foreign DNA. 
D) integrates into the host chromosome. 
A) contains a selectable marker. 
B) contains an origin of replication. 
C) has a site for inserting foreign DNA. 
D) integrates into the host chromosome. D

Question 4

Which of the following is a potential mechanism through which proteins can acquire novel domain architectures over evolutionary time?

Accepted Answer

A) Genome duplication alone 
B) Exon shuffling alone 
C) Exon shuffling followed by genome duplication 
D) Genome duplication followed by exon shuffling 
A) Genome duplication alone 
B) Exon shuffling alone 
C) Exon shuffling followed by genome duplication 
D) Genome duplication followed by exon shuffling

Question 5

What is one way that genes can be predicted in genome sequences?

Accepted Answer

A) Identifying the most conserved sequences between different species. 
B) Identifying the least conserved sequences between different species 
C) Identifying the most conserved regions between individuals of the same species. 
D) Determining which regions have undergone the most rapid evolution. 
A) Identifying the most conserved sequences between different species. 
B) Identifying the least conserved sequences between different species 
C) Identifying the most conserved regions between individuals of the same species. 
D) Determining which regions have undergone the most rapid evolution.

Question 6

Use the BLAST tool at http://blast.ncbi.nlm.nih.gov/Blast.cgi and click "Protein blast" to find out the identity of the protein with the following amino acid sequence: CCKHPEAKRM PCAEDYLSVV LNQLCVLHEK TPVSDRVTKC CTESLVNRRP

Accepted Answer

A) myosin 
B) actin 
C) albumin 
D) DNA polymerase 
E) tubulin 
A) myosin 
B) actin 
C) albumin 
D) DNA polymerase 
E) tubulin

Question 7

Which of the following is an example of a recombinant DNA molecule?

Accepted Answer

A) a single-stranded RNA hybridized to a single-stranded DNA 
B) a genomic fragment of human DNA ligated to a bacterial plasmid vector 
C) a $\lambda$ chromosome in a bacterial cell 
D) a bacterial plasmid cut with a restriction enzyme 
A) a single-stranded RNA hybridized to a single-stranded DNA 
B) a genomic fragment of human DNA ligated to a bacterial plasmid vector 
C) a $\lambda$ chromosome in a bacterial cell 
D) a bacterial plasmid cut with a restriction enzyme

Question 8

What is the sequence of the template DNA used for this sequencing reaction?

Accepted Answer

A) 5' TTTGCTTTGTGAGCGGATAACAA 3' 
B) 3' TTTGCTTTGTGAGCGGATAACAA 5' 
C) 5' AAACGAAACACTCGCCTATTGTT 3' 
D) 3' AAACGAAACACTCGCCTATTGTT 5' 
A) 5' TTTGCTTTGTGAGCGGATAACAA 3' 
B) 3' TTTGCTTTGTGAGCGGATAACAA 5' 
C) 5' AAACGAAACACTCGCCTATTGTT 3' 
D) 3' AAACGAAACACTCGCCTATTGTT 5'

Question 9

Pseudogenes are evidence for

Accepted Answer

A) gene duplications. 
B) the existence of integrated viruses, or proviruses. 
C) the importance of TATA boxes in eukaryotic promoters. 
D) the importance of the order of the globin genes in dictating their expression. 
E) diseases that result from deletions in the a-globin genes. 
A) gene duplications. 
B) the existence of integrated viruses, or proviruses. 
C) the importance of TATA boxes in eukaryotic promoters. 
D) the importance of the order of the globin genes in dictating their expression. 
E) diseases that result from deletions in the a-globin genes.

Question 10

Which of the following is a way that protein function can be modified AFTER translation?

Accepted Answer

A) Protein cleaving 
B) Transcription regulation 
C) Genome duplication 
D) Exon shuffling 
E) Gene rearrangement 
A) Protein cleaving 
B) Transcription regulation 
C) Genome duplication 
D) Exon shuffling 
E) Gene rearrangement

Question 11

What is the use of a RefSeq?

Accepted Answer

A) A RefSeq is a single, complete, annotated version of a species sequence that can be accessed for bioinformatic studies. 
B) RefSeq is constantly updated to give the latest information for bioinformatic studies. 
C) RefSeq is a program to compare genome sequencces. 
D) RefSeq is a program that identifies open reading frames. 
A) A RefSeq is a single, complete, annotated version of a species sequence that can be accessed for bioinformatic studies. 
B) RefSeq is constantly updated to give the latest information for bioinformatic studies. 
C) RefSeq is a program to compare genome sequencces. 
D) RefSeq is a program that identifies open reading frames.

Question 12

Which of the following processes is a way that orthologous genes can be generated over evolutionary time?

Accepted Answer

A) Protein cleaving 
B) Transcription regulation 
C) Genome duplication 
D) Chromosomal rearrangement 
A) Protein cleaving 
B) Transcription regulation 
C) Genome duplication 
D) Chromosomal rearrangement

Question 13

How do bacteria protect their own DNA from the restriction enzymes they produce?

Accepted Answer

A) Their DNA never contains the recognition site. 
B) Ligase connects their DNA as soon as it is cut. 
C) Digestion is blocked by methyl groups added to recognition sequences in their DNA. 
D) Phosphate groups added to the recognition sequences in their DNA block digestion. 
E) Restriction enzymes are blocked from entry into the nucleus. 
A) Their DNA never contains the recognition site. 
B) Ligase connects their DNA as soon as it is cut. 
C) Digestion is blocked by methyl groups added to recognition sequences in their DNA. 
D) Phosphate groups added to the recognition sequences in their DNA block digestion. 
E) Restriction enzymes are blocked from entry into the nucleus.

Question 14

The role of the DNA polymerase in Sanger sequencing is to

Accepted Answer

A) synthesize a copy of the template strand in the 5' to 3' direction. 
B) synthesize the template strand in the 3' to 5' direction 
C) synthesize a copy of the template strand in the 3' to 5' direction. 
D) synthesize the template strand in the 5' to 3' direction 
A) synthesize a copy of the template strand in the 5' to 3' direction. 
B) synthesize the template strand in the 3' to 5' direction 
C) synthesize a copy of the template strand in the 3' to 5' direction. 
D) synthesize the template strand in the 5' to 3' direction

Question 15

What enzyme is necessary for the copying of mRNA sequence into DNA during cDNA library construction?

Accepted Answer

A) RNA polymerase 
B) DNA polymerase 
C) Reverse transcriptase 
D) Restriction endonuclease 
A) RNA polymerase 
B) DNA polymerase 
C) Reverse transcriptase 
D) Restriction endonuclease

Question 16

What is the sequence of the DNA synthesized in the sequencing reaction?

Accepted Answer

A) 5' TTTGCTTTGTGAGCGGATAACAA 3' 
B) 3' TTTGCTTTGTGAGCGGATAACAA 5' 
C) 5' AAACGAAACACTCGCCTATTGTT 3' 
D) 3' AAACGAAACACTCGCCTATTGTT 5' 
A) 5' TTTGCTTTGTGAGCGGATAACAA 3' 
B) 3' TTTGCTTTGTGAGCGGATAACAA 5' 
C) 5' AAACGAAACACTCGCCTATTGTT 3' 
D) 3' AAACGAAACACTCGCCTATTGTT 5'

Question 17

If DNA had 5 different bases, a restriction enzyme with a 4-base recognition sequence would predicted to digest the DNA approximately every

Accepted Answer

A) 125 bp. 
B) 256 bp. 
C) 425 bp. 
D) 625 bp. 
E) 1056 bp. 
A) 125 bp. 
B) 256 bp. 
C) 425 bp. 
D) 625 bp. 
E) 1056 bp.

Question 18

The method of sequencing genomic fragments cloned directly from the genome is:

Accepted Answer

A) Cytogenetic mapping 
B) Shotgun sequencing 
C) Southern blotting 
D) Polymerase chain reaction 
A) Cytogenetic mapping 
B) Shotgun sequencing 
C) Southern blotting 
D) Polymerase chain reaction

Question 19

What information cannot be determined from the DNA sequence of a cDNA clone?

Accepted Answer

A) exon sequences 
B) sequence of the promoter 
C) similarity to previously identified sequences 
D) amino acid sequence of the encoded polypeptides 
E) sequence of the spliced mRNA transcript 
A) exon sequences 
B) sequence of the promoter 
C) similarity to previously identified sequences 
D) amino acid sequence of the encoded polypeptides 
E) sequence of the spliced mRNA transcript

Question 20

Which disease results from deletion of the $\beta$-globin gene cluster LCR?

Accepted Answer

A) Sickle-cell disease 
B) Mild $\beta$-thalassemia. 
C) Severe$\alpha$-thalassemia. 
D) Mild $\beta$-thalassemia 
E) Severe $\beta$-thalassemia 
A) Sickle-cell disease 
B) Mild $\beta$-thalassemia. 
C) Severe$\alpha$-thalassemia. 
D) Mild $\beta$-thalassemia 
E) Severe $\beta$-thalassemia

Exam 9: Digital Analysis of Genomes

What is the function of the ampr gene in a vector?

What is the purpose of ethidium bromide in DNA electrophoresis?

Which choice is NOT a characteristic of a plasmid used as a cloning vector?

Which of the following is a potential mechanism through which proteins can acquire novel domain architectures over evolutionary time?

What is one way that genes can be predicted in genome sequences?

Use the BLAST tool at http://blast.ncbi.nlm.nih.gov/Blast.cgi and click "Protein blast" to find out the identity of the protein with the following amino acid sequence: CCKHPEAKRM PCAEDYLSVV LNQLCVLHEK TPVSDRVTKC CTESLVNRRP

Which of the following is an example of a recombinant DNA molecule?

What is the sequence of the template DNA used for this sequencing reaction?

Pseudogenes are evidence for

Which of the following is a way that protein function can be modified AFTER translation?

What is the use of a RefSeq?

Which of the following processes is a way that orthologous genes can be generated over evolutionary time?

How do bacteria protect their own DNA from the restriction enzymes they produce?

The role of the DNA polymerase in Sanger sequencing is to

What enzyme is necessary for the copying of mRNA sequence into DNA during cDNA library construction?

What is the sequence of the DNA synthesized in the sequencing reaction?

If DNA had 5 different bases, a restriction enzyme with a 4-base recognition sequence would predicted to digest the DNA approximately every

The method of sequencing genomic fragments cloned directly from the genome is:

What information cannot be determined from the DNA sequence of a cDNA clone?

Which disease results from deletion of the β\betaβ -globin gene cluster LCR?

Genetics: The Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: The Flow of Information From DNA to RNA to Protein

Analyzing Genomic Information

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Organellar Inheritance

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

Genetics of Complex Traits

Filters

What is the function of the amp^r gene in a vector?

Which disease results from deletion of the $\beta$ -globin gene cluster LCR?