Deck 12: Gene Mutation

Question 1

An example of a beneficial mutation is

A)a mutation in collagen that causes the skin to be extra stretchy.
B)the mutation that causes sickle cell disease.
C)a mutation in the CCR5 gene.
D)a mutation in a cytokine gene that causes an allergy.

Answer 1

C

Question 2

Mutational hot spots occur most often where the DNA is

A)unwound and stretched.
B)repetitive or symmetrical.
C)highly coiled.
D)bound by RNA polymerase.

Answer 2

B

Question 3

The spontaneous mutation rate for autosomal genes can be estimated using the formula: number of de novo cases/_____X.3-26-2013

A)1
B)2
C)3
D)4

Answer 3

B

Question 4

Spontaneous mutation occurs when

A)a DNA base is in an unstable tautomeric form as the replication fork arrives and a mismatched base is inserted.
B)a person smokes cigarettes or is exposed to a teratogen for many years.
C)the sugars and phosphates in the DNA double helix exchange places.
D)thymine temporarily becomes uracil.

Question 5

A chemical or physical agent that causes mutations is called a

A)mutator.
B)tautomer.
C)teratomer.
D)mutagen.

Question 6

The parents-to-be were shocked when an ultrasound scan done in the second trimester of the pregnancy showed a fetus with obviously broken leg bones and ribs.The doctor diagnosed osteogenesis imperfecta.This is caused by a mutation in a gene that encodes

A)beta globin.
B)a clotting factor.
C)myosin.
D)collagen.

Question 7

Mutations are more likely to occur in repeated DNA sequences because

A)these bases are unstable.
B)bases in the strand can form base pairs,generating loops that interfere with replication and repair enzymes.
C)the repeats hold onto the replication enzymes,causing base mismatches.
D)the repeats attract and bind to mutagens,increasing the mutation rate.

Question 8

Estimates of spontaneous mutation rates are made using dominant disorders because

A)it takes several generations for the phenotype to change.
B)they do not affect offspring.
C)the mutant phenotype is obvious.
D)they can be identified by DNA sequencing.

Question 9

Mutations in the lamin A gene are responsible for very diverse disorders because

A)different tissues have different variants of the gene.
B)lamin A proteins affect how chromatin touches the nuclear membrane.
C)many different results occur.
D)every tissue type has lamin A.

Question 10

The mutation that causes sickle cell disease

A)occurs in the same gene that,when mutant in a different way,causes beta thalassemiA.
B)deletes two contiguous DNA bases.
C)results in a single DNA base change that does not alter the encoded amino acid.
D)changes a glutamic acid to a valine in the alpha globin gene.

Question 11

A germline mutation passes from generation to generation because it occurs during the DNA replication before

A)mitosis.
B)meiosis.
C)fertilization.
D)RNA replication.

Question 12

A somatic mutation

A)occurs only in microbes.
B)affects a particular subset of cells.
C)affects all cells of an individual.
D)is expressed only in embryos.

Question 13

Mutations and polymorphisms are both changes in a DNA sequence,but polymorphisms are more common because

A)they less severely affect the phenotype,so that individuals can reproduce and transmit them.
B)more people have them.
C)mutations are always lethal.
D)mutations refer to a real situation,whereas a polymorphism is an idealized state hypothesized by biologists to explain genetic change.

Question 14

A tautomer is

A)a mutagen.
B)an RNA base.
C)an alternate structure of a molecule.
D)the type of bond that holds DNA bases together.

Question 15

A mutation in a collagen gene is likely to affect the phenotype because

A)it is extremely rare.
B)during meiosis,the chromosome that bears the mutation is more likely to enter a gamete than the chromosome that carries the wild type allele.
C)collagen has a very precise three-dimensional structure,so nearly any disruption alters the overall conformation.
D)people who use cosmetics with collagen silence collagen genes.

Question 16

The first single-gene disorder for which the mechanism of mutation was understood at a molecular level was

A)cystic fibrosis.
B)hemophilia.
C)sickle cell disease.
D)diabetes mellitus.

Question 17

In Ehlers-Danlos syndrome type 1,collagen molecules are

A)too short.
B)missing.
C)too long.
D)too scarce.

Question 18

A man and woman of normal height have a son with achondroplasia.They want to have another child and wonder what the risk is that he or she will also have this form of dwarfism.The risk is

A)0 percent.
B)the same as for any other child in the population.
C)25 percent.
D)50 percent.

Question 19

A mutation is

A)a change in a DNA sequence that affects at least 90 percent of individuals in a population.
B)a change in a DNA sequence that is rare in a population.
C)a change in a DNA sequence that harms health.
D)a type of radiation that can alter the genetic code.

Question 20

Sanjay and Indira have thalassemia minor.Their young daughters are dizygotic (fraternal)twins.Malonie has thalassemia minor like her parents,but Jewel has the more severe thalassemia major.The more serious case most likely arose because

A)Jewel inherited two wild type alleles from her carrier parents.
B)Jewel inherited a dominant form of the condition.
C)Jewel inherited two recessive mutant alleles in the beta globin gene that cause thalassemia.
D)Jewel also has sickle cell disease.

Question 21

The phenotype of a person with alpha thalassemia depends on the

A)number of beta globin genes.
B)presence or absence of a sickle cell mutation.
C)number of alpha globin chains.
D)rate of replication of the alpha globin genes.

Question 22

Four children of a man and woman who are second cousins have too few teeth,which is an autosomal recessive condition called oligodontia caused by mutation in a gene called LTPB3 on chromosome 11.The affected individuals are also short,with increased bone density in the spine and skull.The protein that causes the symptoms by affecting certain bone cells is too short.The mutation in this family is most likely

A)a missense mutation.
B)a nonsense mutation.
C)a duplication of the gene.
D)a replacement of all purines with pyrimidines.

Question 23

A mutation that changes the codon GAA to UAA is a _____ mutation.

A)missense
B)nonsense
C)frameshift
D)truncation

Question 24

Which type of mutation substitutes one amino acid for another?

A)nonsense
B)missense
C)sense
D)antisense

Question 25

Fragile X syndrome is caused by a(n)

A)deletion.
B)translocation.
C)expanding triplet repeat.
D)point mutation.

Question 26

In a form of early-onset Alzheimer disease caused by a mutation on chromosome 14,A is changed to T at the first position of codon 146,which substitutes leucine for methionine.This mutation is a _____ and is _____.

A)transversion;nonsense
B)transversion;missense
C)transition;missense
D)transition;nonsense

Question 27

Which addition to a DNA sequence would not cause a frameshift mutation?

A)T
B)GC
C)GCT
D)GGCT

Question 28

Direct repeats can cause mutation when

A)a person encounters a mutagen.
B)homologs misalign during meiosis such that the first copy of the gene on one chromosome lies opposite the second copy on the homolog.
C)introns are not removed promptly and their sequences are included in the gene product.
D)they bond within the same DNA strand,forming loops that disrupt replication enzymes.

Question 29

Which of the following is a transversion?

A)A to T
B)G to A
C)C to T
D)T to C

Question 30

A researcher might use site-directed mutagenesis because

A)spontaneous mutations occur too frequently to study.
B)using a mutagen yields results that are specific to a gene and not applicable everywhere in the genome.
C)mutation can happen at a specific site in the genome,compared to a mutagen that might cause mutations in several genes.
D)it works in humans but not in experimental organisms or cell culture.

Question 31

A point mutation alters

A)a single base.
B)a chromosome tip.
C)a centromere.
D)only a purine.

Question 32

Acridine dyes are mutagens that

A)disrupt the reading frame of the gene.
B)replace an AT base pair with a GC base pair.
C)reverse the polarity of the double helix.
D)kill cells.

Question 33

A sign that mutation occurred in a person exposed to radiation in the aftermath of the Chernobyl disaster of 1986 was

A)acute radiation sickness in the exposed person.
B)short DNA repeats in a child's genome that didn't match the size in either exposed parent.
C)increased rates of asthma and allergies in the exposed people and their children.
D)a child that failed an Ames test.

Question 34

Missense mutations cause large deletions when they

A)alter a protein's shape and affect its function.
B)alter an intron splicing site so that an entire exon is deleted.
C)change a triplet codon that does not affect the reading frame.
D)invert a segment of a chromosome.

Question 35

Ionizing radiation alters DNA by

A)deleting bases.
B)removing nitrogen from the bases.
C)breaking the sugar-phosphate backbone.
D)reversing replication forks.

Question 36

Palindrome sequences are often found at mutation hotspots.Which of the following is a palindrome?

A)AAAATTTT
B)ATATGCGC
C)GATCCTAG
D)GATCGATC

Question 37

Which of the following is a transition mutation?

A)ACC to CCC
B)A to G
C)GG to AA
D)A to T

Question 38

A source of gamma radiation is

A)plutonium and cesium isotopes.
B)alpha and beta globin.
C)uranium and radium.
D)carbon-14 and strontium-70.

Question 39

A mutation that changes the third position in a CUU codon to a C would

A)result in a frameshift mutation.
B)shorten the protein.
C)have no effect on the protein.
D)also change the first two positions.

Question 40

A missense mutation causes sickle cell disease by

A)altering the protein's shape and affecting its function.
B)changing a triplet codon that does not affect the reading frame.
C)altering an intron splicing site so that an entire exon is deleted.
D)substituting beta globin chains with alpha globin chains.

Question 41

Copy number variants

A)are extremely rare,occurring in only about a dozen sites in the genome.
B)are found only in even-numbered chromosomes.
C)account for about 25 percent of the genome and number in hundreds to thousands.
D)account for less than 1 percent of the genome and are five or fewer bases long.

Question 42

A mutation expressed only under certain conditions is

A)germinal.
B)de novo.
C)conditional.
D)deleterious

Question 43

A mutation is more likely to affect a differentiated cell than a stem cell due to

A)skewed distribution of parental versus newly replicated DNA.
B)a conscious effort on the part of the individual.
C)lack of DNA replication in stem cells.
D)skewed distribution of stem and progenitor cells.

Question 44

Synonymous codons protect against mutation because

A)the encoded amino acid changes to a smaller one.
B)the encoded amino acid changes to a larger one.
C)the encoded amino acid does not change.
D)they are exposed to oxidants.

Question 45

Protection against inherited prion disorders seems to depend upon

A)whether people are heterozygotes at particular part of the prion protein gene.
B)whether people have extra copies of the prion protein gene.
C)whether people eat food contaminated with toxin from
D)whether people eat tainted beef.
E)coli.

Question 46

Homozygotes for hemoglobin C have
3-26-2013

A)sickle cell disease.
B)a normal phenotype.
C)a bluish complexion.
D)a black mouth.

Question 47

A nonfunctional gene near a similar but functional gene is called a(n)

A)pseudogene.
B)expanded gene.
C)phenocopy.
D)transposon.

Question 48

Individuals with _____ develop numerous skin cancers when exposed to sunlight.

A)Ataxia telangiectasis
B)Cockayne syndrome
C)Werner syndrome
D)Xeroderma pigmentosum

Question 49

Ultraviolet light damages DNA by causing

A)purine rings.
B)strand breaks.
C)thymine dimers.
D)radioactivity.

Question 50

Different disease phenotypes caused by mutations in the same gene are termed allelic disorders.

Question 51

Which of the following disorders does not involve faulty DNA repair?

A)Xeroderma pigmentosum
B)Trichothiodystrophy
C)Ataxia telangiectasis
D)Becker muscular dystrophy

Question 52

_____ can usually repair DNA damage caused by ultraviolet light.

A)Photoreactivation
B)Ionizing radiation
C)DNA replication
D)Chromatin remodeling

Question 53

Allelic disorders may result from mutations in different parts of the same gene.

Question 54

Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?

A)GTCCTGATTATTCA
B)GTCCACTTATT
C)GTCCTTATTCAACTTATTCCTG
D)GTCCTTATATTCA

Question 55

The type of DNA repair that corrects errors due to oxidative damage by replacing one to five nucleotides is

A)mismatch repair.
B)base excision repair.
C)roto-rooter repair.
D)photoreactivation.

Question 56

The fact that myotonic dystrophy worsens with each generation is due to

A)a second somatic point mutation.
B)an increasing number of repeated short DNA sequences.
C)a transposing tandem triplet repeat.
D)family members perceiving their symptoms as worse.