Deck 12: Gene Mutation

Full screen (f)
exit full mode
Question
An example of a beneficial mutation is

A)a mutation in collagen that causes the skin to be extra stretchy.
B)the mutation that causes sickle cell disease.
C)a mutation in the CCR5 gene.
D)a mutation in a cytokine gene that causes an allergy.
Use Space or
up arrow
down arrow
to flip the card.
Question
Mutational hot spots occur most often where the DNA is

A)unwound and stretched.
B)repetitive or symmetrical.
C)highly coiled.
D)bound by RNA polymerase.
Question
The spontaneous mutation rate for autosomal genes can be estimated using the formula: number of de novo cases/_____X.3-26-2013

A)1
B)2
C)3
D)4
Question
Spontaneous mutation occurs when

A)a DNA base is in an unstable tautomeric form as the replication fork arrives and a mismatched base is inserted.
B)a person smokes cigarettes or is exposed to a teratogen for many years.
C)the sugars and phosphates in the DNA double helix exchange places.
D)thymine temporarily becomes uracil.
Question
A chemical or physical agent that causes mutations is called a

A)mutator.
B)tautomer.
C)teratomer.
D)mutagen.
Question
The parents-to-be were shocked when an ultrasound scan done in the second trimester of the pregnancy showed a fetus with obviously broken leg bones and ribs.The doctor diagnosed osteogenesis imperfecta.This is caused by a mutation in a gene that encodes

A)beta globin.
B)a clotting factor.
C)myosin.
D)collagen.
Question
Mutations are more likely to occur in repeated DNA sequences because

A)these bases are unstable.
B)bases in the strand can form base pairs,generating loops that interfere with replication and repair enzymes.
C)the repeats hold onto the replication enzymes,causing base mismatches.
D)the repeats attract and bind to mutagens,increasing the mutation rate.
Question
Estimates of spontaneous mutation rates are made using dominant disorders because

A)it takes several generations for the phenotype to change.
B)they do not affect offspring.
C)the mutant phenotype is obvious.
D)they can be identified by DNA sequencing.
Question
Mutations in the lamin A gene are responsible for very diverse disorders because

A)different tissues have different variants of the gene.
B)lamin A proteins affect how chromatin touches the nuclear membrane.
C)many different results occur.
D)every tissue type has lamin A.
Question
The mutation that causes sickle cell disease

A)occurs in the same gene that,when mutant in a different way,causes beta thalassemiA.
B)deletes two contiguous DNA bases.
C)results in a single DNA base change that does not alter the encoded amino acid.
D)changes a glutamic acid to a valine in the alpha globin gene.
Question
A germline mutation passes from generation to generation because it occurs during the DNA replication before

A)mitosis.
B)meiosis.
C)fertilization.
D)RNA replication.
Question
A somatic mutation

A)occurs only in microbes.
B)affects a particular subset of cells.
C)affects all cells of an individual.
D)is expressed only in embryos.
Question
Mutations and polymorphisms are both changes in a DNA sequence,but polymorphisms are more common because

A)they less severely affect the phenotype,so that individuals can reproduce and transmit them.
B)more people have them.
C)mutations are always lethal.
D)mutations refer to a real situation,whereas a polymorphism is an idealized state hypothesized by biologists to explain genetic change.
Question
A tautomer is

A)a mutagen.
B)an RNA base.
C)an alternate structure of a molecule.
D)the type of bond that holds DNA bases together.
Question
A mutation in a collagen gene is likely to affect the phenotype because

A)it is extremely rare.
B)during meiosis,the chromosome that bears the mutation is more likely to enter a gamete than the chromosome that carries the wild type allele.
C)collagen has a very precise three-dimensional structure,so nearly any disruption alters the overall conformation.
D)people who use cosmetics with collagen silence collagen genes.
Question
The first single-gene disorder for which the mechanism of mutation was understood at a molecular level was

A)cystic fibrosis.
B)hemophilia.
C)sickle cell disease.
D)diabetes mellitus.
Question
In Ehlers-Danlos syndrome type 1,collagen molecules are

A)too short.
B)missing.
C)too long.
D)too scarce.
Question
A man and woman of normal height have a son with achondroplasia.They want to have another child and wonder what the risk is that he or she will also have this form of dwarfism.The risk is

A)0 percent.
B)the same as for any other child in the population.
C)25 percent.
D)50 percent.
Question
A mutation is

A)a change in a DNA sequence that affects at least 90 percent of individuals in a population.
B)a change in a DNA sequence that is rare in a population.
C)a change in a DNA sequence that harms health.
D)a type of radiation that can alter the genetic code.
Question
Sanjay and Indira have thalassemia minor.Their young daughters are dizygotic (fraternal)twins.Malonie has thalassemia minor like her parents,but Jewel has the more severe thalassemia major.The more serious case most likely arose because

A)Jewel inherited two wild type alleles from her carrier parents.
B)Jewel inherited a dominant form of the condition.
C)Jewel inherited two recessive mutant alleles in the beta globin gene that cause thalassemia.
D)Jewel also has sickle cell disease.
Question
The phenotype of a person with alpha thalassemia depends on the

A)number of beta globin genes.
B)presence or absence of a sickle cell mutation.
C)number of alpha globin chains.
D)rate of replication of the alpha globin genes.
Question
Four children of a man and woman who are second cousins have too few teeth,which is an autosomal recessive condition called oligodontia caused by mutation in a gene called LTPB3 on chromosome 11.The affected individuals are also short,with increased bone density in the spine and skull.The protein that causes the symptoms by affecting certain bone cells is too short.The mutation in this family is most likely

A)a missense mutation.
B)a nonsense mutation.
C)a duplication of the gene.
D)a replacement of all purines with pyrimidines.
Question
A mutation that changes the codon GAA to UAA is a _____ mutation.

A)missense
B)nonsense
C)frameshift
D)truncation
Question
Which type of mutation substitutes one amino acid for another?

A)nonsense
B)missense
C)sense
D)antisense
Question
Fragile X syndrome is caused by a(n)

A)deletion.
B)translocation.
C)expanding triplet repeat.
D)point mutation.
Question
In a form of early-onset Alzheimer disease caused by a mutation on chromosome 14,A is changed to T at the first position of codon 146,which substitutes leucine for methionine.This mutation is a _____ and is _____.

A)transversion;nonsense
B)transversion;missense
C)transition;missense
D)transition;nonsense
Question
Which addition to a DNA sequence would not cause a frameshift mutation?

A)T
B)GC
C)GCT
D)GGCT
Question
Direct repeats can cause mutation when

A)a person encounters a mutagen.
B)homologs misalign during meiosis such that the first copy of the gene on one chromosome lies opposite the second copy on the homolog.
C)introns are not removed promptly and their sequences are included in the gene product.
D)they bond within the same DNA strand,forming loops that disrupt replication enzymes.
Question
Which of the following is a transversion?

A)A to T
B)G to A
C)C to T
D)T to C
Question
A researcher might use site-directed mutagenesis because

A)spontaneous mutations occur too frequently to study.
B)using a mutagen yields results that are specific to a gene and not applicable everywhere in the genome.
C)mutation can happen at a specific site in the genome,compared to a mutagen that might cause mutations in several genes.
D)it works in humans but not in experimental organisms or cell culture.
Question
A point mutation alters

A)a single base.
B)a chromosome tip.
C)a centromere.
D)only a purine.
Question
Acridine dyes are mutagens that

A)disrupt the reading frame of the gene.
B)replace an AT base pair with a GC base pair.
C)reverse the polarity of the double helix.
D)kill cells.
Question
A sign that mutation occurred in a person exposed to radiation in the aftermath of the Chernobyl disaster of 1986 was

A)acute radiation sickness in the exposed person.
B)short DNA repeats in a child's genome that didn't match the size in either exposed parent.
C)increased rates of asthma and allergies in the exposed people and their children.
D)a child that failed an Ames test.
Question
Missense mutations cause large deletions when they

A)alter a protein's shape and affect its function.
B)alter an intron splicing site so that an entire exon is deleted.
C)change a triplet codon that does not affect the reading frame.
D)invert a segment of a chromosome.
Question
Ionizing radiation alters DNA by

A)deleting bases.
B)removing nitrogen from the bases.
C)breaking the sugar-phosphate backbone.
D)reversing replication forks.
Question
Palindrome sequences are often found at mutation hotspots.Which of the following is a palindrome?

A)AAAATTTT
B)ATATGCGC
C)GATCCTAG
D)GATCGATC
Question
Which of the following is a transition mutation?

A)ACC to CCC
B)A to G
C)GG to AA
D)A to T
Question
A source of gamma radiation is

A)plutonium and cesium isotopes.
B)alpha and beta globin.
C)uranium and radium.
D)carbon-14 and strontium-70.
Question
A mutation that changes the third position in a CUU codon to a C would

A)result in a frameshift mutation.
B)shorten the protein.
C)have no effect on the protein.
D)also change the first two positions.
Question
A missense mutation causes sickle cell disease by

A)altering the protein's shape and affecting its function.
B)changing a triplet codon that does not affect the reading frame.
C)altering an intron splicing site so that an entire exon is deleted.
D)substituting beta globin chains with alpha globin chains.
Question
Copy number variants

A)are extremely rare,occurring in only about a dozen sites in the genome.
B)are found only in even-numbered chromosomes.
C)account for about 25 percent of the genome and number in hundreds to thousands.
D)account for less than 1 percent of the genome and are five or fewer bases long.
Question
A mutation expressed only under certain conditions is

A)germinal.
B)de novo.
C)conditional.
D)deleterious
Question
A mutation is more likely to affect a differentiated cell than a stem cell due to

A)skewed distribution of parental versus newly replicated DNA.
B)a conscious effort on the part of the individual.
C)lack of DNA replication in stem cells.
D)skewed distribution of stem and progenitor cells.
Question
Synonymous codons protect against mutation because

A)the encoded amino acid changes to a smaller one.
B)the encoded amino acid changes to a larger one.
C)the encoded amino acid does not change.
D)they are exposed to oxidants.
Question
Protection against inherited prion disorders seems to depend upon

A)whether people are heterozygotes at particular part of the prion protein gene.
B)whether people have extra copies of the prion protein gene.
C)whether people eat food contaminated with toxin from
D)whether people eat tainted beef.
E)coli.
Question
Homozygotes for hemoglobin C have
3-26-2013

A)sickle cell disease.
B)a normal phenotype.
C)a bluish complexion.
D)a black mouth.
Question
A nonfunctional gene near a similar but functional gene is called a(n)

A)pseudogene.
B)expanded gene.
C)phenocopy.
D)transposon.
Question
Individuals with _____ develop numerous skin cancers when exposed to sunlight.

A)Ataxia telangiectasis
B)Cockayne syndrome
C)Werner syndrome
D)Xeroderma pigmentosum
Question
Ultraviolet light damages DNA by causing

A)purine rings.
B)strand breaks.
C)thymine dimers.
D)radioactivity.
Question
Different disease phenotypes caused by mutations in the same gene are termed allelic disorders.
Question
Which of the following disorders does not involve faulty DNA repair?

A)Xeroderma pigmentosum
B)Trichothiodystrophy
C)Ataxia telangiectasis
D)Becker muscular dystrophy
Question
_____ can usually repair DNA damage caused by ultraviolet light.

A)Photoreactivation
B)Ionizing radiation
C)DNA replication
D)Chromatin remodeling
Question
Allelic disorders may result from mutations in different parts of the same gene.
Question
Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?

A)GTCCTGATTATTCA
B)GTCCACTTATT
C)GTCCTTATTCAACTTATTCCTG
D)GTCCTTATATTCA
Question
The type of DNA repair that corrects errors due to oxidative damage by replacing one to five nucleotides is

A)mismatch repair.
B)base excision repair.
C)roto-rooter repair.
D)photoreactivation.
Question
The fact that myotonic dystrophy worsens with each generation is due to

A)a second somatic point mutation.
B)an increasing number of repeated short DNA sequences.
C)a transposing tandem triplet repeat.
D)family members perceiving their symptoms as worse.
Unlock Deck
Sign up to unlock the cards in this deck!
Unlock Deck
Unlock Deck
1/56
auto play flashcards
Play
simple tutorial
Full screen (f)
exit full mode
Deck 12: Gene Mutation
1
An example of a beneficial mutation is

A)a mutation in collagen that causes the skin to be extra stretchy.
B)the mutation that causes sickle cell disease.
C)a mutation in the CCR5 gene.
D)a mutation in a cytokine gene that causes an allergy.
C
2
Mutational hot spots occur most often where the DNA is

A)unwound and stretched.
B)repetitive or symmetrical.
C)highly coiled.
D)bound by RNA polymerase.
B
3
The spontaneous mutation rate for autosomal genes can be estimated using the formula: number of de novo cases/_____X.3-26-2013

A)1
B)2
C)3
D)4
B
4
Spontaneous mutation occurs when

A)a DNA base is in an unstable tautomeric form as the replication fork arrives and a mismatched base is inserted.
B)a person smokes cigarettes or is exposed to a teratogen for many years.
C)the sugars and phosphates in the DNA double helix exchange places.
D)thymine temporarily becomes uracil.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
5
A chemical or physical agent that causes mutations is called a

A)mutator.
B)tautomer.
C)teratomer.
D)mutagen.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
6
The parents-to-be were shocked when an ultrasound scan done in the second trimester of the pregnancy showed a fetus with obviously broken leg bones and ribs.The doctor diagnosed osteogenesis imperfecta.This is caused by a mutation in a gene that encodes

A)beta globin.
B)a clotting factor.
C)myosin.
D)collagen.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
7
Mutations are more likely to occur in repeated DNA sequences because

A)these bases are unstable.
B)bases in the strand can form base pairs,generating loops that interfere with replication and repair enzymes.
C)the repeats hold onto the replication enzymes,causing base mismatches.
D)the repeats attract and bind to mutagens,increasing the mutation rate.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
8
Estimates of spontaneous mutation rates are made using dominant disorders because

A)it takes several generations for the phenotype to change.
B)they do not affect offspring.
C)the mutant phenotype is obvious.
D)they can be identified by DNA sequencing.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
9
Mutations in the lamin A gene are responsible for very diverse disorders because

A)different tissues have different variants of the gene.
B)lamin A proteins affect how chromatin touches the nuclear membrane.
C)many different results occur.
D)every tissue type has lamin A.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
10
The mutation that causes sickle cell disease

A)occurs in the same gene that,when mutant in a different way,causes beta thalassemiA.
B)deletes two contiguous DNA bases.
C)results in a single DNA base change that does not alter the encoded amino acid.
D)changes a glutamic acid to a valine in the alpha globin gene.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
11
A germline mutation passes from generation to generation because it occurs during the DNA replication before

A)mitosis.
B)meiosis.
C)fertilization.
D)RNA replication.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
12
A somatic mutation

A)occurs only in microbes.
B)affects a particular subset of cells.
C)affects all cells of an individual.
D)is expressed only in embryos.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
13
Mutations and polymorphisms are both changes in a DNA sequence,but polymorphisms are more common because

A)they less severely affect the phenotype,so that individuals can reproduce and transmit them.
B)more people have them.
C)mutations are always lethal.
D)mutations refer to a real situation,whereas a polymorphism is an idealized state hypothesized by biologists to explain genetic change.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
14
A tautomer is

A)a mutagen.
B)an RNA base.
C)an alternate structure of a molecule.
D)the type of bond that holds DNA bases together.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
15
A mutation in a collagen gene is likely to affect the phenotype because

A)it is extremely rare.
B)during meiosis,the chromosome that bears the mutation is more likely to enter a gamete than the chromosome that carries the wild type allele.
C)collagen has a very precise three-dimensional structure,so nearly any disruption alters the overall conformation.
D)people who use cosmetics with collagen silence collagen genes.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
16
The first single-gene disorder for which the mechanism of mutation was understood at a molecular level was

A)cystic fibrosis.
B)hemophilia.
C)sickle cell disease.
D)diabetes mellitus.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
17
In Ehlers-Danlos syndrome type 1,collagen molecules are

A)too short.
B)missing.
C)too long.
D)too scarce.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
18
A man and woman of normal height have a son with achondroplasia.They want to have another child and wonder what the risk is that he or she will also have this form of dwarfism.The risk is

A)0 percent.
B)the same as for any other child in the population.
C)25 percent.
D)50 percent.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
19
A mutation is

A)a change in a DNA sequence that affects at least 90 percent of individuals in a population.
B)a change in a DNA sequence that is rare in a population.
C)a change in a DNA sequence that harms health.
D)a type of radiation that can alter the genetic code.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
20
Sanjay and Indira have thalassemia minor.Their young daughters are dizygotic (fraternal)twins.Malonie has thalassemia minor like her parents,but Jewel has the more severe thalassemia major.The more serious case most likely arose because

A)Jewel inherited two wild type alleles from her carrier parents.
B)Jewel inherited a dominant form of the condition.
C)Jewel inherited two recessive mutant alleles in the beta globin gene that cause thalassemia.
D)Jewel also has sickle cell disease.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
21
The phenotype of a person with alpha thalassemia depends on the

A)number of beta globin genes.
B)presence or absence of a sickle cell mutation.
C)number of alpha globin chains.
D)rate of replication of the alpha globin genes.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
22
Four children of a man and woman who are second cousins have too few teeth,which is an autosomal recessive condition called oligodontia caused by mutation in a gene called LTPB3 on chromosome 11.The affected individuals are also short,with increased bone density in the spine and skull.The protein that causes the symptoms by affecting certain bone cells is too short.The mutation in this family is most likely

A)a missense mutation.
B)a nonsense mutation.
C)a duplication of the gene.
D)a replacement of all purines with pyrimidines.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
23
A mutation that changes the codon GAA to UAA is a _____ mutation.

A)missense
B)nonsense
C)frameshift
D)truncation
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
24
Which type of mutation substitutes one amino acid for another?

A)nonsense
B)missense
C)sense
D)antisense
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
25
Fragile X syndrome is caused by a(n)

A)deletion.
B)translocation.
C)expanding triplet repeat.
D)point mutation.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
26
In a form of early-onset Alzheimer disease caused by a mutation on chromosome 14,A is changed to T at the first position of codon 146,which substitutes leucine for methionine.This mutation is a _____ and is _____.

A)transversion;nonsense
B)transversion;missense
C)transition;missense
D)transition;nonsense
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
27
Which addition to a DNA sequence would not cause a frameshift mutation?

A)T
B)GC
C)GCT
D)GGCT
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
28
Direct repeats can cause mutation when

A)a person encounters a mutagen.
B)homologs misalign during meiosis such that the first copy of the gene on one chromosome lies opposite the second copy on the homolog.
C)introns are not removed promptly and their sequences are included in the gene product.
D)they bond within the same DNA strand,forming loops that disrupt replication enzymes.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
29
Which of the following is a transversion?

A)A to T
B)G to A
C)C to T
D)T to C
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
30
A researcher might use site-directed mutagenesis because

A)spontaneous mutations occur too frequently to study.
B)using a mutagen yields results that are specific to a gene and not applicable everywhere in the genome.
C)mutation can happen at a specific site in the genome,compared to a mutagen that might cause mutations in several genes.
D)it works in humans but not in experimental organisms or cell culture.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
31
A point mutation alters

A)a single base.
B)a chromosome tip.
C)a centromere.
D)only a purine.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
32
Acridine dyes are mutagens that

A)disrupt the reading frame of the gene.
B)replace an AT base pair with a GC base pair.
C)reverse the polarity of the double helix.
D)kill cells.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
33
A sign that mutation occurred in a person exposed to radiation in the aftermath of the Chernobyl disaster of 1986 was

A)acute radiation sickness in the exposed person.
B)short DNA repeats in a child's genome that didn't match the size in either exposed parent.
C)increased rates of asthma and allergies in the exposed people and their children.
D)a child that failed an Ames test.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
34
Missense mutations cause large deletions when they

A)alter a protein's shape and affect its function.
B)alter an intron splicing site so that an entire exon is deleted.
C)change a triplet codon that does not affect the reading frame.
D)invert a segment of a chromosome.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
35
Ionizing radiation alters DNA by

A)deleting bases.
B)removing nitrogen from the bases.
C)breaking the sugar-phosphate backbone.
D)reversing replication forks.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
36
Palindrome sequences are often found at mutation hotspots.Which of the following is a palindrome?

A)AAAATTTT
B)ATATGCGC
C)GATCCTAG
D)GATCGATC
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
37
Which of the following is a transition mutation?

A)ACC to CCC
B)A to G
C)GG to AA
D)A to T
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
38
A source of gamma radiation is

A)plutonium and cesium isotopes.
B)alpha and beta globin.
C)uranium and radium.
D)carbon-14 and strontium-70.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
39
A mutation that changes the third position in a CUU codon to a C would

A)result in a frameshift mutation.
B)shorten the protein.
C)have no effect on the protein.
D)also change the first two positions.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
40
A missense mutation causes sickle cell disease by

A)altering the protein's shape and affecting its function.
B)changing a triplet codon that does not affect the reading frame.
C)altering an intron splicing site so that an entire exon is deleted.
D)substituting beta globin chains with alpha globin chains.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
41
Copy number variants

A)are extremely rare,occurring in only about a dozen sites in the genome.
B)are found only in even-numbered chromosomes.
C)account for about 25 percent of the genome and number in hundreds to thousands.
D)account for less than 1 percent of the genome and are five or fewer bases long.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
42
A mutation expressed only under certain conditions is

A)germinal.
B)de novo.
C)conditional.
D)deleterious
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
43
A mutation is more likely to affect a differentiated cell than a stem cell due to

A)skewed distribution of parental versus newly replicated DNA.
B)a conscious effort on the part of the individual.
C)lack of DNA replication in stem cells.
D)skewed distribution of stem and progenitor cells.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
44
Synonymous codons protect against mutation because

A)the encoded amino acid changes to a smaller one.
B)the encoded amino acid changes to a larger one.
C)the encoded amino acid does not change.
D)they are exposed to oxidants.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
45
Protection against inherited prion disorders seems to depend upon

A)whether people are heterozygotes at particular part of the prion protein gene.
B)whether people have extra copies of the prion protein gene.
C)whether people eat food contaminated with toxin from
D)whether people eat tainted beef.
E)coli.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
46
Homozygotes for hemoglobin C have
3-26-2013

A)sickle cell disease.
B)a normal phenotype.
C)a bluish complexion.
D)a black mouth.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
47
A nonfunctional gene near a similar but functional gene is called a(n)

A)pseudogene.
B)expanded gene.
C)phenocopy.
D)transposon.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
48
Individuals with _____ develop numerous skin cancers when exposed to sunlight.

A)Ataxia telangiectasis
B)Cockayne syndrome
C)Werner syndrome
D)Xeroderma pigmentosum
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
49
Ultraviolet light damages DNA by causing

A)purine rings.
B)strand breaks.
C)thymine dimers.
D)radioactivity.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
50
Different disease phenotypes caused by mutations in the same gene are termed allelic disorders.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
51
Which of the following disorders does not involve faulty DNA repair?

A)Xeroderma pigmentosum
B)Trichothiodystrophy
C)Ataxia telangiectasis
D)Becker muscular dystrophy
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
52
_____ can usually repair DNA damage caused by ultraviolet light.

A)Photoreactivation
B)Ionizing radiation
C)DNA replication
D)Chromatin remodeling
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
53
Allelic disorders may result from mutations in different parts of the same gene.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
54
Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?

A)GTCCTGATTATTCA
B)GTCCACTTATT
C)GTCCTTATTCAACTTATTCCTG
D)GTCCTTATATTCA
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
55
The type of DNA repair that corrects errors due to oxidative damage by replacing one to five nucleotides is

A)mismatch repair.
B)base excision repair.
C)roto-rooter repair.
D)photoreactivation.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
56
The fact that myotonic dystrophy worsens with each generation is due to

A)a second somatic point mutation.
B)an increasing number of repeated short DNA sequences.
C)a transposing tandem triplet repeat.
D)family members perceiving their symptoms as worse.
Unlock Deck
Unlock for access to all 56 flashcards in this deck.
Unlock Deck
k this deck
locked card icon
Unlock Deck
Unlock for access to all 56 flashcards in this deck.