Deck 14: Constant Allele Frequencies

Question 1

Which of the choices best describes macroevolution?

A) Individuals with one genotype reproduce more than individuals with another genotype in a population.
B) Many individuals move into a new area.
C) Mutation creates new alleles that are dominant.
D) A new species emerges.
E) Dominant and recessive allele frequencies are in equilibrium in a population.

Answer 1

D

Question 2

The allele T is in 85 percent of a population (p=0.85).According to the Hardy-Weinberg equation,what percentage of the population will have the recessive allele t (q=?)?

A) 15%
B) 50%
C) 85%
D) 100%
E) 0%

Answer 2

A

Question 3

Gene flow is the

A) migration of individuals between populations.
B) transfer of genes within a population.
C) variation of alleles within a population.
D) movement of alleles between populations.
E) change of normal genes to mutant alleles.

Answer 3

D

Question 4

Tay-Sachs disease affects in 1 in 3,600 Ashkenazim births.The value of q² is

A) 0.1.
B) 0.05.
C) 0.017.
D) 0.0003.
E) 100%.

Question 5

Which group is used to calculate the frequency of an allele in a population?

A) homozygous recessives
B) the most fertile individuals
C) homozygous dominants
D) heterozygotes
E) heterozygous dominants

Question 6

In a population in Hardy-Weinberg equilibrium,the frequency of recessive alleles will _______ over time.

A) increase
B) decrease
C) remain the same
D) increase and then decrease
E) decrease and then increase

Question 7

All of the genes in a population comprise its

A) genotype.
B) gene pool.
C) gene frequency.
D) gene reservoir.
E) genome.

Question 8

An autosomal recessive disorder strikes 1 in 1,800 newborns in a population.The frequency of carriers of this disorder is approximately

A) 0.00055.
B) 0.023.
C) 0.045.
D) 0.5.
E) 100%.

Question 9

The difference between microevolution and macroevolution is that

A) microevolution affects bacteria and macroevolution affects larger organisms.
B) microevolution happens slowly and macroevolution happens quickly.
C) macroevolution happens slowly and microevolution happens quickly.
D) microevolutionary changes are small, and macroevolutionary changes are large.
E) microevolution affects up to 100 base pairs and macroevolution affects chromosomes.

Question 10

If the incidence of an autosomal recessive condition is 1/3,600 live births,what is the carrier frequency?

A) 0.0003
B) 0.029
C) 0.286
D) 0.684
E) near 1.0

Question 11

In the Hardy-Weinberg equation,2pq refers to

A) the proportion of heterozygotes in a population.
B) the number of homozygous dominant individuals in a population.
C) the most common phenotype in a population.
D) individuals who are homozygous recessive.
E) individuals with a mutation.

Question 12

Which of the following would not alter a gene's frequency in a population?

A) mutation
B) migration
C) random mating
D) inbreeding
E) a bottleneck

Question 13

Which choice describes a biological population?

A) a bird, a lizard, and an insect in a cage at a zoo
B) an all-male army
C) people living in an apartment building
D) pebbles on a beach
E) a woman

Question 14

In a population in Hardy-Weinberg equilibrium,75 percent of the individuals have a dominant allele for a particular gene (p=0.75)and 25 percent have a recessive allele (q=0.25).The proportion of homozygous recessive individuals in the F₁ generation will be

A) 2.5%.
B) 6.25%.
C) 18.75%.
D) 25%.
E) 0%.

Question 15

For a very rare inherited disease,the frequency of heterozygotes in a population is

A) half that of the dominant allele.
B) double that of the recessive allele.
C) very close to 0.
D) near 1.
E) 100%.

Question 16

If one person in 50 is a carrier of an autosomal recessive disorder in a population,the chance that an unrelated man and woman are both carriers is

A) 1/50.
B) 1/100.
C) 1/1000.
D) 1/2500.
E) 1/25000.

Question 17

In a population in Hardy-Weinberg equilibrium,frequency of a dominant allele is

A) p.
B) p².
C) 2pq.
D) q.
E) 100%.

Question 18

Hardy-Weinberg equilibrium is possible only if the population is

A) small, with no migration out of in, and females outnumbering males.
B) large, with random mating and no migration, mutation, genetic drift, or natural selection.
C) small, with nonrandom mating and no migration, mutation, genetic drift, or artificial selection.
D) large, with nonrandom mating, mutation, genetic drift, and natural selection.
E) comprised of very young and fertile individuals and no newcomers arrive.

Question 19

Hardy-Weinberg calculations are based on

A) the binomial expansion.
B) the quadratic equation.
C) the Pythagorean theorem.
D) comparing DNA sequences.
E) monitoring phenotypes.

Question 20

If the incidence of Tay-Sachs is 1/3,600 Ashkenazim births,what is the heterozygote (carrier)frequency?

A) 0.0003
B) 0.029
C) 0.286
D) 0.684
E) near 1.0

Question 21

An RFLP is a

A) DNA probe used for hybridization experiments.
B) variation in size of a DNA segment cut by a specific restriction enzyme.
C) recessive form of a deleterious allele.
D) restrictive enzyme used to cut DNA.
E) copy number variant used in forensic investigations.

Question 22

Which of the following have the longest DNA sequences?

A) VNTRs
B) STRs
C) SNPs
D) thymine dimers
E) base pairs

Question 23

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

A) VNTR.
B) STR.
C) RFLP.
D) SNP.
E) protein-encoding gene.

Question 24

A series of markers have the following frequencies.Which would be the most useful for DNA profiling?

A) 1/60
B) 1/5,200
C) 1/500
D) 1/40
E) 1/10

Question 25

DNA profiling was less useful in identifying remains from the 2004 tsunami than in criminal cases because

A) the DNA after the tsunami was too wet to analyze.
B) rescuers could not get to the scene of the tsunami in time to collect DNA.
C) the tsunami left few bodies with collectible DNA.
D) not enough repeats were profiled.
E) none of the victims were listed in the FBI's files.

Question 26

Mitochondrial DNA is helpful in obtaining a DNA profile for very degraded genetic material because

A) cells have many mitochondria, and therefore several copies of mtDNA sequences.
B) the mitochondrial outer membrane protects it from being damaged.
C) mitochondria contain oxidative enzymes that protect the DNA.
D) mtDNA consists of a single helix, so it cannot be unwound.
E) it uses uracil instead of thymine, which is a more stable nitrogenous base.

Question 27

A "cold hit" refers to

A) a DNA profile made from frozen DNA, such as from a wooly mammoth.
B) identifying a suspect from DNA alone.
C) a technology to preserve DNA.
D) using CODIS to identify the victim of a crime.
E) using mitochondrial DNA to take a DNA profile.

Question 28

In order to identify (or rule out identity)from a DNA sample that is a mixture,the investigator should know

A) how long the DNA has been exposed to the environment.
B) how the person perished.
C) the population groups to which the person of interest belongs or belonged.
D) the genome sequence of the suspect or missing person.
E) whether RNA is in the sample.

Question 29

VNTRs and STRs differ in that

A) a VNTR repeat is shorter than an STR repeat.
B) a VNTR repeat is longer than an STR repeat.
C) a VNTR is a type of copy number variant and an STR is not.
D) an STR is a type of copy number variant and a VNTR is not.
E) criminals have VNTRs and non-criminals have STRs.

Question 30

A suspect's guilt seems highly likely when a very rare combination of markers is

A) found in the population the suspect comes from and at the crime scene.
B) not found in the population the suspect comes from, but present at the crime scene.
C) found in the suspect's DNA but not at the crime scene or in the population the suspect comes from.
D) found in the population the suspect comes from, in the suspect's DNA, and at the crime scene.
E) not found in the population the suspect comes from, in the suspect's DNA, or at the crime scene.

Question 31

Who invented DNA profiling?

A) Godfrey Hardy
B) William Weinberg
C) Alec Jeffreys
D) Linus Pauling
E) Godfrey Hardy and William Weinberg

Question 32

Frequency of an X-linked recessive allele in males equals

A) p².
B) 2pq.
C) q².
D) q.
E) 100%.

Question 33

DNA analysis to determine genetic identity applies

A) Mendel's law of independent assortment and the product rule.
B) Mendel's law of segregation and the product rule.
C) the central dogma.
D) the law of polymorphism.
E) Darwin's mathematical principles.

Question 34

Principles of population genetics must be applied to determine identity based on DNA profiling because

A) VNTRs are not found in all populations.
B) individuals are their own populations.
C) random mating does not occur in all populations.
D) alleles are invariant between all human populations.
E) some populations may be too small to base conclusions.

Question 35

CODIS is

A) a fifteen-base DNA sequence used in DNA profiling.
B) a type of mutation used in forensic applications.
C) a system for crime laboratories to share DNA profiles.
D) the last name of the person who invented DNA profiling.
E) a technology used to amplify DNA found at crime scenes.

Question 36

A common source of DNA for forensic testing is

A) the skin between the toes.
B) a skin scraped from inside the cheek.
C) the liver.
D) red blood cells.
E) mucus.

Question 37

The parts of the genome that are used in markers of identity in DNA profiling

A) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype.
B) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype.
C) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype.
D) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype.
E) have very distinctive phenotypes that are associated with particular populations.