Deck 13: Gene Mutations, Transposable Elements, and Dna Repair

Question 1

Which of the following kinds of mutations is MOST likely to be a null loss-of-function?

A)Transition
B)Transversion
C)Frameshift
D)Missense
E)Induced

Answer 1

C

Question 2

Assume that a base-pair substitution mutation converts a DNA triplet (AAT)to another DNA triplet (AAA).A second mutation now changes the AAA triplet to the GAA triplet.(UUA and CUU code for leucine, and UUU codes for phenylalanine.)This second mutation is an example of a(n):

A)transversion.
B)intragenic suppressor.
C)loss-of-function mutation.
D)intergenic suppressor.
E)frameshift.

Answer 2

B

Question 3

Some mutations cause new alleles that are helpful in a population, whereas some mutations can be deleterious, such as those that cause:

A)altered gene expression.
B)new protein forms.
C)gene duplications.
D)genetic disease.
E)new phenotypes.

Answer 3

D

Question 4

Huntington disease can strike at an earlier age and bring about a more rapid degeneration and death in successive generations within a family.This phenomenon can be explained by which mechanism?

A)Presence of a transposable element in the gene
B)Chronic exposure to mutagens in the environment
C)Expansion of a trinucleotide repeat in the coding sequence of the gene
D)Presence of an extra chromosome in the germ line
E)Absence of a gene product that is involved in DNA repair

Question 5

The mutation shown in the diagram below can best be described as a _____ mutation.

A)missense
B)nonsense
C)silent
D)neutral
E)reverse

Question 6

An example of a genetic disorder in humans that results from a loss-of-function mutation is:

A)cystic fibrosis.
B)achondroplasia.
C)Huntington disease.
D)myotonic dystrophy.
E)None of the answers is correct.

Question 7

The type of mutation that reverses the effects of a frameshift mutation without changing the frameshift and occurs with the same gene as the frameshift is called a(n)_____ mutation.

A)intergenic suppressor
B)nonsense
C)missense
D)intragenic suppressor
E)silent

Question 8

How do germ-line mutations differ from somatic mutations?

A)Germ-line mutations involve small changes to DNA such as base-pair substitutions, while somatic mutations usually involve large deletions.
B)Germ-line mutations occur during DNA replication, while somatic mutations do not.
C)Germ-line mutations result in mutant gametes, while somatic mutations do not.
D)Germ-line mutations are reversible, while somatic mutations are not.
E)Germ-line mutations result in cancers, while somatic mutations do not.

Question 9

Which of the following CORRECTLY describes nonsense mutations?

A)They cause a nonfunctional amino acid to replace a functional amino acid.
B)They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein.
C)They result in the insertion or deletion of a small number of nucleotides to the DNA.
D)They convert a codon for a particular amino acid within a gene into a stop codon.
E)They cannot revert or back-mutate to wild-type.

Question 10

Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?

A)Missense
B)Nonsense
C)Neutral
D)Silent
E)Loss-of-function

Question 11

_____ mutations produce new activities and are usually dominant.

A)Induced
B)Spontaneous
C)Forward
D)Gain-of-function
E)Lethal

Question 12

What is the consequence of a transversion mutation in duplex DNA?

A)A purine is replaced by a pyrimidine, and a pyrimidine is replaced by a purine.
B)A base pair is lost within the DNA of a gene, which causes a reading frameshift.
C)A purine is replaced by another purine, and a pyrimidine is replaced by another pyrimidine.
D)A base pair is added to the DNA within a gene, which causes a reading frameshift.
E)The sequence of the DNA remains the same since the change involves proteins.

Question 13

Which of the following statements about an animal bearing a somatic mutation is TRUE?

A)Some, but not all, of the animal's offspring will also carry the mutation.
B)All of the animal's offspring will carry the mutation.
C)Both the animal and its offspring will show the mutant trait.
D)The animal but not its offspring can be affected by the mutation.
E)The gametes produced by the animal will all carry the mutation.

Question 14

Which of the following statements about somatic mutations is FALSE?

A)Some may give rise to cancers in humans and other animals.
B)They may be inherited by daughter cells after cell division.
C)They may result in inactive gene products of the mutated genes.
D)They may result from both frameshift and base-pair substitution mutations.
E)They may be inherited in the offspring of mutated individuals.

Question 15

Fragile-X syndrome is an example of a disease caused by what type of mutation?

A)Nonsense mutation
B)Frameshift mutation
C)Expanding nucleotide repeat
D)Loss-of-function
E)Gain-of-function

Question 16

Insertion or removal of one or more nucleotide base pairs in DNA within a gene often results in a _____ mutation.

A)transition
B)frameshift
C)reversion
D)transversion
E)suppressor

Question 17

A _____ mutation changes a codon that specifies an amino acid into one that terminates translation.

A)missense
B)nonsense
C)silent
D)neutral
E)reverse

Question 18

A mutation that changes a GC base pair to AT is a(n):

A)transition.
B)transversion.
C)induced mutation.
D)missense mutation.
E)synonymous mutation.

Question 19

Which of the following base changes in DNA is an example of a transition?

A)A-to-C
B)G-to-C
C)C-to-A
D)A-to-G
E)A-to-T

Question 20

The tinman mutation discovered in Drosophila is an example of how a geneticist can use mutants to study their effects on:

A)gene expression.
B)a biological system.
C)missense mutations.
D)genetic suppression.
E)normal development.

Question 21

Which of the following characterizes the mode of transposition of retrotransposons?

A)It involves an RNA intermediate.
B)It involves the initial synthesis of transposase.
C)It involves the production of a protein repressor.
D)It only occurs in nondividing host genomes.
E)It requires inverted repeats at each end of the retrotransposon.

Question 22

A nonreplicative transposon does not leave a copy at its original site upon transposition.In contrast, a replicative transposon:

A)leaves two copies at the original site.
B)creates an original copy and a new one in the genome.
C)leaves two copies at the new insertion site.
D)replicates itself at the original site but does not create a new copy in the genome.
E)leaves a deletion at the original site.

Question 23

Which of the following mutagens is MOST likely to cause a frameshift mutation?

A)Base analog
B)Alkylating agent
C)Intercalating agent
D)Ionizing radiation
E)UV light

Question 24

Assume that during DNA replication in a bacterium a mistake is made and a G is inserted into the newly synthesized DNA strand opposite a T in the template DNA strand.If this mistake is not repaired before the next round of DNA replication, what mutation will eventually result?

A)A-to-G base substitution
B)A-to-C base substitution
C)A-to-T base substitution
D)G-to-A base substitution
E)C-to-A base substitution

Question 25

Upon transposing to a new site, transposable elements:

A)add methyl groups to bases of the surrounding DNA.
B)delete about 100 base pairs of DNA on each side of them.
C)duplicate their transposase gene.
D)express a gene that confers sensitivity to some common antibiotics.
E)create a duplication of a target sequence on each side of them.

Question 26

Which of the following describes the possible parasitic nature of transposable elements?

A)Transposable elements can increase in number within genomes without providing an advantage to the host.
B)Transposable elements are collected within their genomes by host organisms so that the host will benefit, but not the transposable elements.
C)Transposable elements will provide an evolutionary advantage to host organisms by transposing as often as possible.
D)Transposable elements will enhance their expression of transposase so that the hosts can evolve more quickly.
E)Transposable elements will add methyl groups to their own DNA to reduce their own rate of transposition.

Question 27

A scientist created a new auxotrophic mutant of bacteria that is leu^- for a new Ames test.In order for the mutant to grow in the absence of leucine, a(n)_____ mutation would have to occur in the _____ gene.

A)missense; leu^-
B)intragenic reversion; leu^-
C)nonsense; leu^-
D)intergenic reversion; leu^-
E)silent; leu^-

Question 28

Transposable elements are found:

A)mainly in higher plants.
B)mainly in animals, particularly in mammals.
C)mainly in eukaryotes.
D)mainly in prokaryotes.
E)in practically all organisms.

Question 29

It is estimated that transposable elements compose approximately what percent of the human genome?

A)<1%
B)1%
C)10%
D)50%
E)99%

Question 30

What do alkylating agents do?

A)They cause pyrimidine dimers.
B)They add methyl or ethyl groups to bases.
C)They oxidize guanine.
D)They deaminate cytosine.
E)All of the answers are correct.

Question 31

Transposition can involve exchange of DNA sequences and recombination, which often leads to DNA:

A)acetylation.
B)rearrangements.
C)condensation.
D)repair.
E)replication.

Question 32

Suppose a research study shows that people who suffer from severe depression are homozygous for a mutation in the hypothetical DEP gene.Individuals without this form of depression have the following sequence at the beginning of the translated region of their DEP genes 5'-ATG ACG TTT GAA ATT CAG TCT AGA-3'(MET THR PHE GLU ILE GLN SER ARG).Affected individuals have the following sequence 5'-ATG ACG TTT GAA ATT TAG TCT AGA-3'(MET THR PHE GLU ILE STOP).The mutation identified is most likely a:

A)missense.
B)gain of function.
C)nonsense.
D)frameshift.
E)deletion.

Question 33

Ultraviolet light causes what type of DNA lesion?

A)Large deletions
B)Deaminated cytosines
C)Pyrimidine dimers
D)Mismatch bases
E)Depurinations

Question 34

Which of the following is the MOST common transposable element in humans?

A)copia
B)Alu
C)Ac
D)Ty
E)P

Question 35

Helen has type I osteogenesis imperfecta (OI), a genetic skeletal disorder.Shown below is her DNA sequence for a portion of the coding region of the collagen type I gene, which contains the mutation responsible for her disorder.The corresponding wild-type sequence is shown also (only one DNA strand is shown in each case). Helen 5'-AAACTCCACTTCTTCCAGTAC-3'
Normal 5'-AAACTCACTTCTTCCAGTAC-3'
What type of mutation does Helen carry?

A)Missense
B)Nonsense
C)Silent
D)Deletion
E)Frameshift

Question 36

In the Ames test, what types of mutations are used to test for chemical mutagens?

A)his^- to his⁺ mutations
B)pro^- to pro⁺ mutations
C)pro⁺ to pro^-mutations
D)his⁺ to his^- mutations
E)trp⁺ to trp^- mutations

Question 37

Assume that you discovered a new chemical mutagen that modifies guanine so that is mispairs with adenine when adenine is in the template DNA strand during DNA replication.However, this mispairing is limited to when the modified guanine is being added to the newly replicating DNA strand.When the modified guanine is in the template DNA strand it always pairs normally with cytosine being added to the growing newly-synthesized strand.What type of mutation would you predict would be caused by the new chemical mutagen?

A)A-to-G base substitutions
B)A-to-C base substitutions
C)A-to-T base substitutions
D)A-to-G and A-to-C base substitutions
E)G-to-T base substitutions

Question 38

Achondroplasia is a form of dwarfism that is inherited in humans as an autosomal dominant.A survey in a small country showed that, within a 2-year period, there were 12 children with normal parents born with this disorder out of a total of 420, 000 births.What is the mutation rate in mutations/locus/generation?

A)1)4 × 10^-5
B)2)8 × 10^-6
C)2)5 × 10^-5
D)2)8 × 10^-5
E)7)4 × 10^-6

Question 39

Practically all transposable elements that have been studied are associated with which of the following?

A)Indirect repeats at each end
B)A gene for transposase
C)A gene for reverse transcriptase
D)A gene for RNA polymerase
E)Flanking direct repeats

Question 40

Which of the following is characteristic of retrotransposons?

A)They use transposase to transpose to new sites.
B)They have inverted repeats at each of their ends.
C)They transpose through an RNA intermediate.
D)They make transposase.
E)They are found only in prokaryotes.

Question 41

Which of the following is a form of direct DNA repair?

A)Base-excision repair
B)Nucleotide excision repair
C)Homologous recombination
D)Mismatch repair
E)Photoreactivation

Question 42

A codon for the amino acid serine undergoes a transversion so that it now codes for threonine.A transversion at a different site in the same codon then suppresses the first mutation.Give the nucleotides in the original codon, the transition mutation, and the transversion suppressor.(Note: There are two possible answers.)

Question 43

Reversions, or reverse mutations (i.e., mutations that restore the wild-type phenotype initially lost by an earlier mutation), can be either of two types: back mutations or suppressor mutations.How you could distinguish between these two different types of reversions?

Question 44

How do intergenic and intragenic suppressor mutations differ?

Question 45

What is the difference between a missense mutation and a nonsense mutation?

Question 46

Consider two theoretical transposable elements in yeast, A and B.Each contains an intron and each transposed to a new location in the yeast genome.Suppose you then examine the transposons for the presence of the intron.In the new locations, you find that A has no intron but B does.From these facts, what can you conclude about the mechanisms of transposition for the two transposable elements?

A)B probably makes a transposase.
B)A probably has inverted repeats at each end of the element.
C)B probably uses RNA as an intermediate in the transposition event.
D)B probably makes a reverse transcriptase.
E)A probably doesn't create a duplication of the host genome target sequence.

Question 47

Explain how an individual with a suppressor mutation can be a double mutant but express a near normal phenotype.

Question 48

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Question 49

A transposable element is found to use RNA as an intermediate in transposition.On the basis of this information, which of the following would you expect to be CORRECT?

A)The transposable element also probably makes transposase.
B)The transposable element may encode a reverse transcriptase.
C)The transposable element is probably located in a bacterial genome.
D)The transposable element probably contains inverted repeats at each end.
E)The transposable element will not be able to transpose without a second copy also present in the genome.

Question 50

You are working on an insulin-binding protein from fish.The beginning of the coding sequence of the gene is shown below.You find a mutant in the gene that cannot bind insulin (also shown below).Among a population of fish that have the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below).What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.)

Question 51

What is the function of DNA glycosylases?

A)Recognize and cleave phosphodiester bonds in DNA
B)Recognize and remove modified bases from the sugar component of DNA
C)Reattach the two parts of DNA that result from double-strand breaks
D)Remove pyrimidine dimers from DNA of E.coli that result from exposure to UV light
E)Prevent strand slippage during DNA replication

Question 52

A diploid fungal cell is homozygous for a (TTG)₅ trinucleotide repeat at a particular locus (see sequence below).During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other.How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.)
ATGTTGTTGTTGTTGTTGTGA

Question 53

The disorder xeroderma pigmentosum is associated with a defect in what type of DNA repair system?

A)Mismatch repair
B)Base-excision repair
C)Reactivation
D)Nucleotide-excision repair
E)Homologous recombination

Question 54

How will the result of strand slippage on the newly synthesized strand differ from the result of strand slippage on the template strand?

Question 55

What is an evolutionary consequence of transposable elements?

A)Transposons play a large role in the expansion of eukaryotic genomes in size.
B)Transposons are involved in extensive genome rearrangements.
C)Transposon insertions can cause new DNA sequences that alter gene expression patterns.
D)All of the answers are correct.
E)None of the answers is correct.

Question 56

Which of the following enzyme activities is NOT a part of nucleotide-excision repair?

A)DNA polymerase
B)DNA ligase
C)Reverse transcriptase
D)DNA helicase
E)All of the answers are part of nucleotide-excision repair.

Question 57

Strains of E.coli that are defective in mismatch repair have very high levels of spontaneous mutagenesis.Studies have shown that in wild-type strains, A:C and G:T mispairings (as opposed to the normal A:T and G:C pairings)that occur during DNA replication are more likely than other mispairings (A:G, etc.)to be detected and.Which of the following types of base substitutions would you expect to be MOST common among the spectrum of spontaneous mutations created by the mutant mismatch repair-defective strains?

A)A-to-C
B)C-to-A
C)G-to-C
D)A-to-G
E)A-to-T

Question 58

Which of the following pairs of sequences would you expect to be found in the same transposable element?

A)Inverted repeats and a gene for transposase
B)Long-terminal repeats and a gene for transposase
C)Inverted repeats and a gene for reverse transcriptase
D)A gene for transposase and a gene for reverse transcriptase
E)Both long-terminal repeats and a gene for transposase AND inverted repeats and a gene for reverse transcriptase are correct.

Question 59

What are the differences between neutral mutations and silent mutations?

Question 60

Which of the following pairs of DNA-repair systems will repair pyrimidine dimers in E.coli?

A)Mismatch repair and base-excision repair
B)Photoreactivation and mismatch repair
C)Nucleotide-excision repair and base-excision repair
D)SOS repair
E)Nonhomologous end joining and nucleotide-excision repair

Question 61

How can spontaneous mutations arise?

Question 62

During mismatch repair it is essential for the cell to be able to distinguish between the old template DNA strand and the newly synthesized DNA strand in order to make the appropriate correction of a mispairing created during DNA replication.How is this accomplished in E.coli?

Question 63

What would be the result of a large deletion in the resolvase gene of a transposable element?

Question 64

Explain how transposable elements might play a role in studying gene function.

Question 65

What is the difference between a mutagen and a carcinogen?

Question 66

The mutagen EMS converts guanine (G)to O-6-ethylguanine (G*).O-6-ethylguanine (G*)forms base pairs with thymine (T)instead of cytosine (C).Suppose that exposure to EMS damages a DNA molecule as shown below. Characterize the mutation induced by EMS as a transition, transversion, or frameshift.

Question 67

Transposable elements that transpose through an RNA intermediate are retrotransposons.There are two types of retrotransposons, those that have direct repeats at each end, often called long terminal repeats (LTRs), and those that do not have these repeats.Pick an example of each type of retrotransposon and give: (1)its basic structure, and (2)its possible evolutionary history.

Question 68

To determine whether human exposure to radiation results in an increase in recessive mutations in the germ line, scientists can examine the sex ratio of children born to parents exposed to higher than normal radiation levels.Explain how and why the sex ratio might be affected by radiation exposure.

Question 69

A company has invented a new low-calorie sugar substitute.They want to determine if the substitute might be carcinogenic, so they use it in the Ames test.The results show no increase in mutant bacterial colonies.They then perform feeding experiments in laboratory rats and find a significant increase in the incidence of cancer.Offer an explanation for why the Ames test did not accurately predict the carcinogenic potential of the sugar substitute, and suggest a solution to the problem.

Question 70

Explain how UV light induces mutations in E.coli.

Question 71

Why do disruptive DNA lesions, like deletions and insertions, sometimes not lead to frameshift mutations?

Question 72

How do insertion sequences and composite transposons differ?

Question 73

Why don't transposable elements that move through replicative transposition eventually take over the genome completely?

Question 74

Most transposable elements are flanked by direct DNA repeats.What is the significance of these direct repeats?

Question 75

Assume you are a geneticist and you're asked to examine the effects of a radiation leak that occurred at a facility in Iraq several years ago.How would you assess the level of mutations caused by this leak?

Question 76

In a eukaryotic cell, two different transposable elements, each containing an intron, excise and insert in different locations within the genome.After transposition, the transposable elements are sequenced at their new sites.Explain the following sequencing results.
a.Neither of the translocated transposable elements contains any intron sequences.
b.One of the transposable elements contains the intron, but the other transposable elements do not.