Solved

This Sequence Is the 5′ End of a MRNA: 5′

Question 16

Multiple Choice

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded? A) Phe Asp His B) Met Asn Gly Trp C) Met Asn Gly D) Translation will not begin. This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded? A) Phe Asp His B) Met Asn Gly Trp C) Met Asn Gly D) Translation will not begin.
-If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?


A) Phe Asp His
B) Met Asn Gly Trp
C) Met Asn Gly
D) Translation will not begin.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q11: Which step in producing ATP is correctly

Q12: Due to gene transfer between the organelles

Q13: Variegated four o'clock leaves have white patches

Q14: What does DNA sequencing suggest about the

Q15: Which of the following has been associated

Q17: Where are the proteins needed for photosynthesis

Q18: LHON is a mitochondrial disease caused by

Q19: Researchers combined two yeast strains of opposite

Q20: For what purpose is a researcher likely

Q21: LHON is a rare mitochondrial disease caused