Solved

This Sequence Is the 5′ End of a MRNA: 5′

Question 29

Multiple Choice

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded? A) Phe Asp His B) Met Asn Gly Trp C) Met Asn Gly D) Translation will not begin. This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded? A) Phe Asp His B) Met Asn Gly Trp C) Met Asn Gly D) Translation will not begin.
-If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded?


A) Phe Asp His
B) Met Asn Gly Trp
C) Met Asn Gly
D) Translation will not begin.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q21: LHON is a rare mitochondrial disease caused

Q22: What does UGA specify? (Select all that

Q23: What did comparing the sequence of the

Q24: Which statement describes evidence in support of

Q25: In four o'clock plants, reciprocal crosses are

Q26: What are characteristics of the pedigrees of

Q27: In plant cells, DNA molecules are found

Q28: Researchers combined two yeast strains of opposite

Q30: Where are the molecules used to carry

Q31: Which is true about mitochondria?<br>A)The mitochondrial genome