You Are Working on an Insulin-Binding Protein from Fish

Short Answer

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg