Use the Pre-MRNA Sequence Shown Below to Answer the Following

Essay

Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided.
b. Predict what would happen if the G in the 5' splice site were mutated to a C.
c. We learned in this chapter that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation? How can you experimentally demonstrate that a 5' cap is important for this process?