Which of the Following Fragments Would Be Generated When the Following

Multiple Choice

Which of the following fragments would be generated when the following sequence is cut by SmaI?
5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3'

A) One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment
B) One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment
C) Two 19 bp fragments
D) One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment