Essay
Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC
Correct Answer:
Verified
The sequences have 29 nucleotides. The f...View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q16: Describe the intracellular endosymbiosis between algae of
Q17: Which energy-production reactions were likely to have
Q18: Discuss what horizontal gene transfer is. How
Q19: Appearance of a new trait in experimental
Q20: Explain how banded iron formations could arise
Q22: The Long-Term Evolution Experiment (LTEE) has been
Q23: How can plants be so efficient photosynthetically
Q24: The disease filariasis is caused by the
Q25: Briefly discuss the types of geological evidence
Q26: Evidence in the study of adaptive evolution