Multiple Choice
Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 
A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Correct Answer:
Verified
Correct Answer:
Verified
Q45: In tRNA,an amino acid is covalently bonded
Q46: The lac repressor has been mutated so
Q47: Using the following chart,which chain of amino
Q48: Which of the following is NOT a
Q49: Changing even a few bases in a
Q51: During RNA splicing<br>A) introns are removed from
Q52: Each tRNA molecule has a site at
Q53: The series of bases in mRNA that
Q54: It is possible for a mutation to
Q55: Which of the following is the best