Multiple Choice
Which of the following cells are pluripotent? (Check all that apply)
A) embryonic stem cells
B) embryonic germ cells
C) neuronal cells
D) epithelial cells
E) red blood cells
Correct Answer:
Verified
Correct Answer:
Verified
Related Questions
Q1: Which of the following is an example
Q6: Unipotent cells may differentiate into all other
Q20: Small circular pieces of bacterial DNA that
Q35: Which of the following is an example
Q35: In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you
Q37: Bone marrow transplants typically use what type
Q41: An organism that can be regenerated from
Q43: What occurs during the annealing stage of
Q44: Which procedure is used to identify a
Q45: What is the purpose of RT(reverse transcriptase)-PCR?<br>A)