Solved

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC

Question 30

Multiple Choice

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The primer used for replication in vitro is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively?


A) Left, left
B) Right, left
C) Left, right
D) Right, right

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q11: Responsible for the majority of DNA replication.<br>A)

Q13: The Meselson-Stahl experiments supported the model of

Q25: DNA polymerases are unable to bind to

Q28: The Meselson-Stahl experiments used <sup>35</sup>S radioisotopes to

Q29: The proofreading of the DNA occurs in

Q30: The purpose of DNA replication is to

Q32: In eukaryotes, which of the following is

Q32: Prevents supercoiling ahead of the replication fork.<br>A)

Q33: The first generation of replication in the

Q40: DNA polymerases add new nucleotides in what