Here Are Noncoding Sequences from Mary and Bob

Multiple Choice

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12:
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?

A) Mary and Bob are most likely fraternal twins.
B) Mary has five STRs at this site;Bob has two.
C) Mary has one STR at this site;Bob has none.
D) The DNA shown must be from the 23rd chromosome,not the 12th.
E) None of the above.