Essay
Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How would you align the three sequences so that they could be used for making comparisons?
Correct Answer:
Verified
To properly align the sequences, a gap s...View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q131: Before nucleotide and amino acid sequences can
Q132: When a gene is duplicated, which of
Q133: The human genome contains _ genes.<br>A) less
Q134: Nonsynonymous mutations in a gene coding for
Q135: Gene duplication may involve<br>A) part of a
Q136: In the amino acid sequences shown in
Q138: Which of the following statements about genome
Q139: The alignment of the amino acid sequences
Q140: Which of the following statements about genomes
Q141: The best way to detect whether lateral