Multiple Choice
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
A) two
B) three
C) four
D) five
Correct Answer:
Verified
Correct Answer:
Verified
Q31: A transgenic animal is an animal<br>A) that
Q32: Suppose a researcher is interested in using
Q33: Cystic fibrosis is an autosomal recessive genetic
Q34: After DNA fragments with matching sticky ends
Q35: What other enzyme is the Cas9 enzyme
Q37: Which is a transgenic organism?<br>A) a fern
Q38: Genetically modifying _ cells may directly affect
Q39: The number of proteins in humans<br>A) is
Q40: Approximately what percentage of human DNA does
Q41: What type of cell is the Cas9