Short Answer
A diploid fungal cell is homozygous for a (TTG)5 trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.)
ATGTTGTTGTTGTTGTTGTGA
Correct Answer:
Answered by ExamLex AI
To solve this problem, we need to unders...View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Correct Answer:
Answered by ExamLex AI
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q16: A company has invented a new low-calorie
Q17: Why do disruptive DNA lesions, like deletions
Q18: Upon transposing to a new site, transposable
Q19: A codon for the amino acid serine
Q20: What do alkylating agents do?<br>A) They cause
Q22: Give the inverted repeat of the following
Q23: The mutation shown in the diagram below
Q24: Which of the following statements about somatic
Q25: Explain how bacterial resistance to antibiotics can
Q26: A transposable element is found to use