Solved

Referring to the Image Above,what Is the Amino Acid Sequence

Question 81

Multiple Choice

   Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA? A) asp-gly-val-glu-glu-trp-tyr B) leu-pro-glu-leu-leu-thr-ile C) ile-thr-leu-leu-gly-pro-leu D) ser-arg-arg-met-gly-val-stop E) met-gly-val-lys-ser-gly-stop    Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?


A) asp-gly-val-glu-glu-trp-tyr
B) leu-pro-glu-leu-leu-thr-ile
C) ile-thr-leu-leu-gly-pro-leu
D) ser-arg-arg-met-gly-val-stop
E) met-gly-val-lys-ser-gly-stop

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q3: Proteins that regulate gene expression by directly

Q22: Which enzyme unwinds the DNA during transcription?​<br>A)

Q31: The tightly condensed nonfunctional X chromosome is

Q63: Identify the type of mutation associated with

Q65: What is the genetic code?<br>A) all of

Q73: Female secondary sexual traits, such as functional

Q77: What does it mean that the genetic

Q81: Mutations in an intron region of a

Q83: How much of the human genome actually

Q85: <img src="https://d2lvgg3v3hfg70.cloudfront.net/TB5951/.jpg" alt=" Referring to the