Question 1

Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

Accepted Answer

A) asp-gly-val-glu-glu-trp-tyr 
B) leu-pro-glu-leu-leu-thr-ile 
C) ile-thr-leu-leu-gly-pro-leu 
D) ser-arg-arg-met-gly-val-stop 
E) met-gly-val-lys-ser-gly-stop 
A) asp-gly-val-glu-glu-trp-tyr 
B) leu-pro-glu-leu-leu-thr-ile 
C) ile-thr-leu-leu-gly-pro-leu 
D) ser-arg-arg-met-gly-val-stop 
E) met-gly-val-lys-ser-gly-stop

Question 2

What is the genetic code?

Accepted Answer

A) all of our genes collectively 
B) all of our base-pairs collectively 
C) the genetic "words" that code for amino acids 
D) the genes in DNA that code for proteins 
E) the genes that encode protein products 
A) all of our genes collectively 
B) all of our base-pairs collectively 
C) the genetic "words" that code for amino acids 
D) the genes in DNA that code for proteins 
E) the genes that encode protein products

Question 3

How much of the human genome actually codes for protein products?

Accepted Answer

A) 2% 
B) 26% 
C) 48% 
D) 71% 
E) 100% 
A) 2% 
B) 26% 
C) 48% 
D) 71% 
E) 100%

Question 4

Which enzyme unwinds the DNA during transcription?

Accepted Answer

A) helicase 
B) DNA polymerase 
C) DNA replicase 
D) RNA polymerase 
E) RNA replicase 
A) helicase 
B) DNA polymerase 
C) DNA replicase 
D) RNA polymerase 
E) RNA replicase

Question 5

Referring to the image above,what is the most likely sequence of DNA that codes for the amino acid sequence is asn-tyr-phe-ser-pro?

Accepted Answer

A) AACTATAAATCACCA 
B) GGGCCATGTAAACTA 
C) CUUAUAAAAAGUUGA 
D) TTGATAAAAAGTGGT 
E) TTGATCGGAAGTTGA 
A) AACTATAAATCACCA 
B) GGGCCATGTAAACTA 
C) CUUAUAAAAAGUUGA 
D) TTGATAAAAAGTGGT 
E) TTGATCGGAAGTTGA

Question 6

Proteins that regulate gene expression by directly binding to the DNA are known as _____.

Accepted Answer

A) transcription factors 
B) translation factors 
C) transposable elements 
D) methylation 
E) phosphorylation 
A) transcription factors 
B) translation factors 
C) transposable elements 
D) methylation 
E) phosphorylation

Question 7

For eukaryotes,translation takes place in the _____.

Accepted Answer

A) nucleus 
B) nucleolus 
C) cytoplasm 
D) plasma membrane 
E) nucleus and cytoplasm 
A) nucleus 
B) nucleolus 
C) cytoplasm 
D) plasma membrane 
E) nucleus and cytoplasm

Question 8

Match each term with the most appropriate description.
-an mRNA code for one amino acid

Accepted Answer

A) anticodon 
B) rRNA 
C) codon 
D) ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)promoters
I)transcription
J)translation 
A) anticodon 
B) rRNA 
C) codon 
D) ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)promoters
I)transcription
J)translation

Question 9

Which RNA acts as an enzyme?

Accepted Answer

A) mRNA 
B) rRNA 
C) tRNA 
D) mRNA and rRNA 
E) rRNA and tRNA 
A) mRNA 
B) rRNA 
C) tRNA 
D) mRNA and rRNA 
E) rRNA and tRNA

Question 10

The first amino acid in a growing polypeptide chain is  _____.

Accepted Answer

A) methionine 
B) valine 
C) lysine 
D) phenylalanine 
E) glycine 
A) methionine 
B) valine 
C) lysine 
D) phenylalanine 
E) glycine

Question 11

Epigenetics is most closely associated with _____.

Accepted Answer

A) base-pair substitution 
B) methylation 
C) Barr bodies 
D) hydrolysis 
E) phosphorylation 
A) base-pair substitution 
B) methylation 
C) Barr bodies 
D) hydrolysis 
E) phosphorylation

Question 12

Match each term with the most appropriate description.
-complex with proteins to form ribosomes

Accepted Answer

A) Anticodon 
B) rRNA 
C) Codon 
D) Ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)Promoters
I)Transcription
J)Translation 
A) Anticodon 
B) rRNA 
C) Codon 
D) Ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)Promoters
I)Transcription
J)Translation

Question 13

Which type of molecule is ricin?

Accepted Answer

A) protein 
B) lipid 
C) nucleic acid 
D) carbohydrate 
E) mineral 
A) protein 
B) lipid 
C) nucleic acid 
D) carbohydrate 
E) mineral

Question 14

Match each term with the most appropriate description.
-a tRNA triplet complementary to a mRNA codon

Accepted Answer

A) Anticodon 
B) rRNA 
C) Codon 
D) Ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)Promoters
I)Transcription
J)Translation 
A) Anticodon 
B) rRNA 
C) Codon 
D) Ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)Promoters
I)Transcription
J)Translation

Question 15

A gene is a DNA sequence that codes for a protein or _____ product.

Accepted Answer

A) RNA 
B) DNA 
C) ribosomes 
D) a lipid 
E) exons 
A) RNA 
B) DNA 
C) ribosomes 
D) a lipid 
E) exons

Question 16

Translation stops when _____.

Accepted Answer

A) enzymes attach to the mRNA molecule at the end of the transcript 
B) a certain number of codons have been read 
C) one of the three stop codons is encountered 
D) the cell runs out of tRNA 
E) stop codon tRNAs add guanine caps to the newly formed peptide 
A) enzymes attach to the mRNA molecule at the end of the transcript 
B) a certain number of codons have been read 
C) one of the three stop codons is encountered 
D) the cell runs out of tRNA 
E) stop codon tRNAs add guanine caps to the newly formed peptide

Question 17

Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA,what happens to that first tRNA?

Accepted Answer

A) it remains attached to the rRNA 
B) it moves into the nucleus to get more instructions from mRNA 
C) it breaks down into its component nucleotides 
D) it leaves the ribosome and may pick up another amino acid 
E) it transforms into an mRNA molecule 
A) it remains attached to the rRNA 
B) it moves into the nucleus to get more instructions from mRNA 
C) it breaks down into its component nucleotides 
D) it leaves the ribosome and may pick up another amino acid 
E) it transforms into an mRNA molecule

Question 18

Match each term with the most appropriate description.
-site at which RNA polymerase binds and initiates transcription

Accepted Answer

A) anticodon 
B) rRNA 
C) codon 
D) ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)promoters
I)transcription
J)translation 
A) anticodon 
B) rRNA 
C) codon 
D) ribosome 
E) genetic code
F)translation termination
G)messenger RNA
H)promoters
I)transcription
J)translation

Question 19

In eukaryotes,DNA is transcribed in the _____.

Accepted Answer

A) mitochondria 
B) cytoplasm 
C) ribosomes 
D) nucleus 
E) endoplasmic reticulum 
A) mitochondria 
B) cytoplasm 
C) ribosomes 
D) nucleus 
E) endoplasmic reticulum

Question 20

Heritable changes in gene expression not due to changes in DNA sequences are known as _____.

Accepted Answer

A) epigenetics 
B) methylation 
C) translational mutation 
D) differentiation 
E) frameshift inheritance 
A) epigenetics 
B) methylation 
C) translational mutation 
D) differentiation 
E) frameshift inheritance

Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

What is the genetic code?

How much of the human genome actually codes for protein products?

Which enzyme unwinds the DNA during transcription?

Referring to the image above,what is the most likely sequence of DNA that codes for the amino acid sequence is asn-tyr-phe-ser-pro?

Proteins that regulate gene expression by directly binding to the DNA are known as _____.

For eukaryotes,translation takes place in the _____.

Match each term with the most appropriate description. -an mRNA code for one amino acid

Which RNA acts as an enzyme?

The first amino acid in a growing polypeptide chain is _____.

Epigenetics is most closely associated with _____.

Match each term with the most appropriate description. -complex with proteins to form ribosomes

Which type of molecule is ricin?

Match each term with the most appropriate description. -a tRNA triplet complementary to a mRNA codon

A gene is a DNA sequence that codes for a protein or _____ product.

Translation stops when _____.

Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA,what happens to that first tRNA?

Match each term with the most appropriate description. -site at which RNA polymerase binds and initiates transcription

In eukaryotes,DNA is transcribed in the _____.

Heritable changes in gene expression not due to changes in DNA sequences are known as _____.

Invitation To Biology

Molecules Of Life

Cell Structure

Energy And Metabolism

Capturing And Releasing Energy

DNA Structure And Function

How Cells Reproduce

Patterns Of Inheritance

Biotechnology

Evidence Of Evolution

Processes Of Evolution

Early Life Forms And The Viruses

Plants And Fungi

Animal Evolution

Population Ecology

Communities And Ecosystems

The Biosphere And Human Effects

Filters

Exam 7: Gene Expression AND Control

Referring to the image above,what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

What is the genetic code?

How much of the human genome actually codes for protein products?

Which enzyme unwinds the DNA during transcription?

Referring to the image above,what is the most likely sequence of DNA that codes for the amino acid sequence is asn-tyr-phe-ser-pro?

Proteins that regulate gene expression by directly binding to the DNA are known as _____.

For eukaryotes,translation takes place in the _____.

Match each term with the most appropriate description. -an mRNA code for one amino acid

Which RNA acts as an enzyme?

The first amino acid in a growing polypeptide chain is _____.

Epigenetics is most closely associated with _____.

Match each term with the most appropriate description. -complex with proteins to form ribosomes

Which type of molecule is ricin?

Match each term with the most appropriate description. -a tRNA triplet complementary to a mRNA codon

A gene is a DNA sequence that codes for a protein or _____ product.

Translation stops when _____.

Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA,what happens to that first tRNA?

Match each term with the most appropriate description. -site at which RNA polymerase binds and initiates transcription

In eukaryotes,DNA is transcribed in the _____.

Heritable changes in gene expression not due to changes in DNA sequences are known as _____.

Invitation To Biology

Molecules Of Life

Cell Structure

Energy And Metabolism

Capturing And Releasing Energy

DNA Structure And Function

How Cells Reproduce

Patterns Of Inheritance

Biotechnology

Evidence Of Evolution

Processes Of Evolution

Early Life Forms And The Viruses

Plants And Fungi

Animal Evolution

Population Ecology

Communities And Ecosystems

The Biosphere And Human Effects

Filters