Multiple Choice
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
A) 0 times
B) 1 time
C) 2 times
D) 3 times
Correct Answer:
Verified
Correct Answer:
Verified
Related Questions
Q24: FGA is one of the STRs that
Q25: Of these steps, which one occurs earliest
Q26: What is the definition of a genetically
Q27: Which enzyme is used to bind DNA
Q28: Cutting DNA with a particular restriction enzyme
Q30: When plasmids are used to produce a
Q31: Approximately what percentage of the human genome
Q32: Cystic fibrosis is a serious respiratory disease
Q33: Golden rice 2 is a genetically modified
Q34: Gel electrophoresis separates DNA fragments on the