Multiple Choice
You are performing a mobility shift assay with a protein complex that is composed of proteins A,B,C,& D,each of which can bind to the DNA of interest.You run the gel with the lanes as follows:
Lane 1: Protein A + DNA
Lane 2: Proteins A + B + DNA
Lane 3: Proteins A + B + C + DNA
Lane 4: Proteins A + B + C + D + DNA
In which lane will the DNA run closest to the top of the gel?
A) Lane 4
B) Lane 3
C) Lane 2
D) Lane 1
Correct Answer:

Verified
Correct Answer:
Verified
Q3: What is the purpose of RNaseH in
Q26: Which technique is best suited to identify
Q27: Although Dolly was only three years old,her
Q28: Select the technique that can be used
Q29: Detection of a product in real-time PCR
Q30: Which of the following terms describes a
Q32: Restriction endonucleases recognize specific DNA sequences.
Q33: Which of the following would contain both
Q35: In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you
Q35: Which of the following is an example