Multiple Choice
Which of the following terms describes a cell that can form any other cell of the organism?
A) pluripotent
B) totipotent
C) unipotent
D) All of the answers are correct.
Correct Answer:
Verified
Correct Answer:
Verified
Related Questions
Q3: What is the purpose of RNaseH in
Q25: Select the reagents needed for PCR.Choose all
Q26: Which technique is best suited to identify
Q27: Although Dolly was only three years old,her
Q28: Select the technique that can be used
Q29: Detection of a product in real-time PCR
Q31: You are performing a mobility shift assay
Q32: Restriction endonucleases recognize specific DNA sequences.
Q33: Which of the following would contain both
Q35: In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you